Incidental Mutation 'R5919:Slc9a3'
ID 462583
Institutional Source Beutler Lab
Gene Symbol Slc9a3
Ensembl Gene ENSMUSG00000036123
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms 9030624O13Rik, NHE-3, NHE3
MMRRC Submission 044116-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5919 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 74121457-74169442 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 74158740 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 328 (T328I)
Ref Sequence ENSEMBL: ENSMUSP00000152682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]
AlphaFold G3X939
Predicted Effect probably damaging
Transcript: ENSMUST00000036208
AA Change: T328I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: T328I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 457 3.6e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221703
AA Change: T328I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225423
AA Change: T328I

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T C 1: 151,915,498 D104G probably damaging Het
2610507B11Rik A T 11: 78,289,350 N2152I probably damaging Het
6030458C11Rik A T 15: 12,823,668 H40Q probably damaging Het
Abcc3 A G 11: 94,357,306 V1156A possibly damaging Het
Adgrl1 G T 8: 83,932,610 D648Y probably damaging Het
Adgrl3 C A 5: 81,646,570 D547E probably benign Het
Aebp1 A T 11: 5,871,421 M607L probably benign Het
Angptl1 T C 1: 156,858,546 Y401H probably damaging Het
Arl4d A G 11: 101,667,136 T163A probably benign Het
Camk2b A G 11: 5,979,718 S331P probably damaging Het
Ccdc15 C T 9: 37,320,396 probably null Het
Ccdc38 A T 10: 93,578,838 I370F possibly damaging Het
Clstn1 A T 4: 149,635,246 H416L probably damaging Het
Col12a1 C T 9: 79,602,298 R3030H probably damaging Het
Cop1 T A 1: 159,319,724 V540E probably damaging Het
Crebbp C T 16: 4,108,127 R710H probably damaging Het
Dsel T C 1: 111,860,253 I851V probably benign Het
Esrp1 A G 4: 11,344,146 V642A probably damaging Het
Fam71e2 T C 7: 4,770,386 E144G possibly damaging Het
Fanci T C 7: 79,444,738 L1139P probably damaging Het
Fat1 T C 8: 45,026,873 probably null Het
Fsip2 A G 2: 82,992,609 N6229D possibly damaging Het
Gas2l3 G A 10: 89,417,055 R243W probably damaging Het
Gm7102 T C 19: 61,175,469 Y176C probably damaging Het
Gm8251 T C 1: 44,056,986 N1651D probably benign Het
Hectd1 G A 12: 51,769,072 R1406W probably damaging Het
Hecw2 T C 1: 53,937,090 H180R probably damaging Het
Ift172 T A 5: 31,260,662 Q1261L possibly damaging Het
Il17rd T C 14: 27,096,044 V230A probably damaging Het
Kif17 A T 4: 138,269,891 I42F probably damaging Het
Kif24 T C 4: 41,394,477 K799E possibly damaging Het
Lrp4 A T 2: 91,473,207 I84F probably damaging Het
Mroh7 T C 4: 106,694,312 probably null Het
Ms4a14 C A 19: 11,314,297 V13F possibly damaging Het
Muc2 T A 7: 141,694,928 V445D probably damaging Het
Muc6 A T 7: 141,641,570 M1317K possibly damaging Het
Myof T A 19: 38,024,370 D39V possibly damaging Het
Ndufaf1 A C 2: 119,660,228 V117G possibly damaging Het
Ndufs1 C G 1: 63,143,832 *728S probably null Het
Nup188 A T 2: 30,339,894 N1375Y probably damaging Het
Oasl1 T A 5: 114,928,270 I149N probably damaging Het
Olfr1504 A G 19: 13,887,845 Y122H probably damaging Het
Pelo C A 13: 115,089,309 C204F possibly damaging Het
Phf11d A C 14: 59,356,263 probably benign Het
Rars2 T C 4: 34,657,232 L526P probably damaging Het
Rrp1 A G 10: 78,405,588 L177P probably damaging Het
S100a9 A G 3: 90,695,188 L33P probably damaging Het
Slc4a7 A G 14: 14,791,092 D1045G probably benign Het
Spata6 A G 4: 111,779,208 D232G probably damaging Het
Taar6 A T 10: 23,985,270 I126N probably damaging Het
Tcrg-V6 A G 13: 19,190,612 Y16C probably benign Het
Tmeff2 C A 1: 51,132,152 C182* probably null Het
Tmem178 T A 17: 80,989,758 C190S probably damaging Het
Trerf1 T G 17: 47,323,282 noncoding transcript Het
Ubn2 A G 6: 38,491,488 I1046V possibly damaging Het
Vmn1r221 A T 13: 23,217,296 noncoding transcript Het
Vmn2r2 T C 3: 64,137,302 N141S probably benign Het
Zfp64 T A 2: 168,926,499 N398Y probably benign Het
Zfp787 T G 7: 6,132,835 Q139P probably damaging Het
Other mutations in Slc9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Slc9a3 APN 13 74160302 missense probably benign 0.19
IGL01299:Slc9a3 APN 13 74160263 missense probably benign 0.33
IGL01390:Slc9a3 APN 13 74150761 missense probably benign 0.01
IGL01814:Slc9a3 APN 13 74165972 missense probably damaging 0.96
IGL02020:Slc9a3 APN 13 74158848 missense probably damaging 0.99
IGL02072:Slc9a3 APN 13 74165859 missense probably benign 0.00
IGL02186:Slc9a3 APN 13 74163114 missense possibly damaging 0.94
IGL02878:Slc9a3 APN 13 74165357 nonsense probably null
IGL03056:Slc9a3 APN 13 74150819 missense probably damaging 1.00
R0090:Slc9a3 UTSW 13 74158728 missense probably damaging 0.99
R0280:Slc9a3 UTSW 13 74159424 missense probably damaging 1.00
R0359:Slc9a3 UTSW 13 74157607 missense probably damaging 1.00
R0388:Slc9a3 UTSW 13 74121536 missense unknown
R0396:Slc9a3 UTSW 13 74157784 critical splice donor site probably null
R0893:Slc9a3 UTSW 13 74159246 missense probably damaging 1.00
R1169:Slc9a3 UTSW 13 74150743 missense probably damaging 0.98
R1640:Slc9a3 UTSW 13 74158818 missense probably damaging 1.00
R1769:Slc9a3 UTSW 13 74163071 missense probably benign 0.00
R1850:Slc9a3 UTSW 13 74161770 missense probably benign 0.34
R1937:Slc9a3 UTSW 13 74166056 splice site probably null
R2048:Slc9a3 UTSW 13 74163741 missense probably damaging 1.00
R2146:Slc9a3 UTSW 13 74121603 missense probably benign 0.00
R2495:Slc9a3 UTSW 13 74158703 missense probably damaging 0.99
R2883:Slc9a3 UTSW 13 74158760 missense probably damaging 1.00
R2938:Slc9a3 UTSW 13 74121669 missense possibly damaging 0.62
R4538:Slc9a3 UTSW 13 74161732 missense possibly damaging 0.56
R4580:Slc9a3 UTSW 13 74158886 nonsense probably null
R4581:Slc9a3 UTSW 13 74164165 missense probably damaging 0.99
R4841:Slc9a3 UTSW 13 74165837 missense probably damaging 1.00
R4928:Slc9a3 UTSW 13 74157719 missense probably damaging 1.00
R4965:Slc9a3 UTSW 13 74164293 missense possibly damaging 0.62
R5079:Slc9a3 UTSW 13 74164287 missense probably damaging 0.97
R5329:Slc9a3 UTSW 13 74150960 missense possibly damaging 0.94
R5663:Slc9a3 UTSW 13 74163712 missense probably damaging 0.98
R5876:Slc9a3 UTSW 13 74161723 missense probably damaging 1.00
R6060:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R6562:Slc9a3 UTSW 13 74155161 missense probably damaging 1.00
R6645:Slc9a3 UTSW 13 74164172 missense probably damaging 0.99
R7145:Slc9a3 UTSW 13 74150678 missense probably damaging 0.99
R7422:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R7565:Slc9a3 UTSW 13 74157694 missense probably damaging 1.00
R7679:Slc9a3 UTSW 13 74160276 missense possibly damaging 0.88
R8032:Slc9a3 UTSW 13 74157644 missense probably damaging 1.00
R8080:Slc9a3 UTSW 13 74166027 missense probably benign 0.30
R8158:Slc9a3 UTSW 13 74155122 missense probably damaging 1.00
R8159:Slc9a3 UTSW 13 74164288 missense probably benign 0.01
R8837:Slc9a3 UTSW 13 74157704 missense probably damaging 1.00
R8939:Slc9a3 UTSW 13 74163776 missense possibly damaging 0.93
R9111:Slc9a3 UTSW 13 74150801 missense probably damaging 1.00
Z1176:Slc9a3 UTSW 13 74165856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAGAGGCCTGCAATGTCATC -3'
(R):5'- TGTGACCTAAACTGAGGGAGCC -3'

Sequencing Primer
(F):5'- CCTGCAATGTCATCAGAGAAACTGG -3'
(R):5'- GCTACTACTAAGAGTGCTCCTAG -3'
Posted On 2017-02-28