Incidental Mutation 'R5919:Slc9a3'
ID 462583
Institutional Source Beutler Lab
Gene Symbol Slc9a3
Ensembl Gene ENSMUSG00000036123
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms NHE3, NHE-3, 9030624O13Rik
MMRRC Submission 044116-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5919 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 74269576-74317561 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 74306859 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 328 (T328I)
Ref Sequence ENSEMBL: ENSMUSP00000152682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]
AlphaFold G3X939
Predicted Effect probably damaging
Transcript: ENSMUST00000036208
AA Change: T328I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: T328I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 457 3.6e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221703
AA Change: T328I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225423
AA Change: T328I

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T C 1: 151,791,249 (GRCm39) D104G probably damaging Het
6030458C11Rik A T 15: 12,823,754 (GRCm39) H40Q probably damaging Het
Abcc3 A G 11: 94,248,132 (GRCm39) V1156A possibly damaging Het
Adgrl1 G T 8: 84,659,239 (GRCm39) D648Y probably damaging Het
Adgrl3 C A 5: 81,794,417 (GRCm39) D547E probably benign Het
Aebp1 A T 11: 5,821,421 (GRCm39) M607L probably benign Het
Angptl1 T C 1: 156,686,116 (GRCm39) Y401H probably damaging Het
Arl4d A G 11: 101,557,962 (GRCm39) T163A probably benign Het
Bltp2 A T 11: 78,180,176 (GRCm39) N2152I probably damaging Het
Camk2b A G 11: 5,929,718 (GRCm39) S331P probably damaging Het
Ccdc15 C T 9: 37,231,692 (GRCm39) probably null Het
Ccdc168 T C 1: 44,096,146 (GRCm39) N1651D probably benign Het
Ccdc38 A T 10: 93,414,700 (GRCm39) I370F possibly damaging Het
Clstn1 A T 4: 149,719,703 (GRCm39) H416L probably damaging Het
Col12a1 C T 9: 79,509,580 (GRCm39) R3030H probably damaging Het
Cop1 T A 1: 159,147,294 (GRCm39) V540E probably damaging Het
Crebbp C T 16: 3,925,991 (GRCm39) R710H probably damaging Het
Dsel T C 1: 111,787,983 (GRCm39) I851V probably benign Het
Esrp1 A G 4: 11,344,146 (GRCm39) V642A probably damaging Het
Fanci T C 7: 79,094,486 (GRCm39) L1139P probably damaging Het
Fat1 T C 8: 45,479,910 (GRCm39) probably null Het
Fsip2 A G 2: 82,822,953 (GRCm39) N6229D possibly damaging Het
Garin5b T C 7: 4,773,385 (GRCm39) E144G possibly damaging Het
Gas2l3 G A 10: 89,252,917 (GRCm39) R243W probably damaging Het
Hectd1 G A 12: 51,815,855 (GRCm39) R1406W probably damaging Het
Hecw2 T C 1: 53,976,249 (GRCm39) H180R probably damaging Het
Ift172 T A 5: 31,418,006 (GRCm39) Q1261L possibly damaging Het
Il17rd T C 14: 26,818,001 (GRCm39) V230A probably damaging Het
Kif17 A T 4: 137,997,202 (GRCm39) I42F probably damaging Het
Kif24 T C 4: 41,394,477 (GRCm39) K799E possibly damaging Het
Lrp4 A T 2: 91,303,552 (GRCm39) I84F probably damaging Het
Mplkipl1 T C 19: 61,163,907 (GRCm39) Y176C probably damaging Het
Mroh7 T C 4: 106,551,509 (GRCm39) probably null Het
Ms4a14 C A 19: 11,291,661 (GRCm39) V13F possibly damaging Het
Muc2 T A 7: 141,281,171 (GRCm39) V445D probably damaging Het
Muc6 A T 7: 141,227,837 (GRCm39) M1317K possibly damaging Het
Myof T A 19: 38,012,818 (GRCm39) D39V possibly damaging Het
Ndufaf1 A C 2: 119,490,709 (GRCm39) V117G possibly damaging Het
Ndufs1 C G 1: 63,182,991 (GRCm39) *728S probably null Het
Nup188 A T 2: 30,229,906 (GRCm39) N1375Y probably damaging Het
Oasl1 T A 5: 115,066,329 (GRCm39) I149N probably damaging Het
Or9i16 A G 19: 13,865,209 (GRCm39) Y122H probably damaging Het
Pelo C A 13: 115,225,845 (GRCm39) C204F possibly damaging Het
Phf11d A C 14: 59,593,712 (GRCm39) probably benign Het
Rars2 T C 4: 34,657,232 (GRCm39) L526P probably damaging Het
Rrp1 A G 10: 78,241,422 (GRCm39) L177P probably damaging Het
S100a9 A G 3: 90,602,495 (GRCm39) L33P probably damaging Het
Slc4a7 A G 14: 14,791,092 (GRCm38) D1045G probably benign Het
Spata6 A G 4: 111,636,405 (GRCm39) D232G probably damaging Het
Taar6 A T 10: 23,861,168 (GRCm39) I126N probably damaging Het
Tmeff2 C A 1: 51,171,311 (GRCm39) C182* probably null Het
Tmem178 T A 17: 81,297,187 (GRCm39) C190S probably damaging Het
Trerf1 T G 17: 47,634,208 (GRCm39) noncoding transcript Het
Trgv6 A G 13: 19,374,782 (GRCm39) Y16C probably benign Het
Ubn2 A G 6: 38,468,423 (GRCm39) I1046V possibly damaging Het
Vmn1r221 A T 13: 23,401,466 (GRCm39) noncoding transcript Het
Vmn2r2 T C 3: 64,044,723 (GRCm39) N141S probably benign Het
Zfp64 T A 2: 168,768,419 (GRCm39) N398Y probably benign Het
Zfp787 T G 7: 6,135,834 (GRCm39) Q139P probably damaging Het
Other mutations in Slc9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Slc9a3 APN 13 74,308,421 (GRCm39) missense probably benign 0.19
IGL01299:Slc9a3 APN 13 74,308,382 (GRCm39) missense probably benign 0.33
IGL01390:Slc9a3 APN 13 74,298,880 (GRCm39) missense probably benign 0.01
IGL01814:Slc9a3 APN 13 74,314,091 (GRCm39) missense probably damaging 0.96
IGL02020:Slc9a3 APN 13 74,306,967 (GRCm39) missense probably damaging 0.99
IGL02072:Slc9a3 APN 13 74,313,978 (GRCm39) missense probably benign 0.00
IGL02186:Slc9a3 APN 13 74,311,233 (GRCm39) missense possibly damaging 0.94
IGL02878:Slc9a3 APN 13 74,313,476 (GRCm39) nonsense probably null
IGL03056:Slc9a3 APN 13 74,298,938 (GRCm39) missense probably damaging 1.00
R0090:Slc9a3 UTSW 13 74,306,847 (GRCm39) missense probably damaging 0.99
R0280:Slc9a3 UTSW 13 74,307,543 (GRCm39) missense probably damaging 1.00
R0359:Slc9a3 UTSW 13 74,305,726 (GRCm39) missense probably damaging 1.00
R0388:Slc9a3 UTSW 13 74,269,655 (GRCm39) missense unknown
R0396:Slc9a3 UTSW 13 74,305,903 (GRCm39) critical splice donor site probably null
R0893:Slc9a3 UTSW 13 74,307,365 (GRCm39) missense probably damaging 1.00
R1169:Slc9a3 UTSW 13 74,298,862 (GRCm39) missense probably damaging 0.98
R1640:Slc9a3 UTSW 13 74,306,937 (GRCm39) missense probably damaging 1.00
R1769:Slc9a3 UTSW 13 74,311,190 (GRCm39) missense probably benign 0.00
R1850:Slc9a3 UTSW 13 74,309,889 (GRCm39) missense probably benign 0.34
R1937:Slc9a3 UTSW 13 74,314,175 (GRCm39) splice site probably null
R2048:Slc9a3 UTSW 13 74,311,860 (GRCm39) missense probably damaging 1.00
R2146:Slc9a3 UTSW 13 74,269,722 (GRCm39) missense probably benign 0.00
R2495:Slc9a3 UTSW 13 74,306,822 (GRCm39) missense probably damaging 0.99
R2883:Slc9a3 UTSW 13 74,306,879 (GRCm39) missense probably damaging 1.00
R2938:Slc9a3 UTSW 13 74,269,788 (GRCm39) missense possibly damaging 0.62
R4538:Slc9a3 UTSW 13 74,309,851 (GRCm39) missense possibly damaging 0.56
R4580:Slc9a3 UTSW 13 74,307,005 (GRCm39) nonsense probably null
R4581:Slc9a3 UTSW 13 74,312,284 (GRCm39) missense probably damaging 0.99
R4841:Slc9a3 UTSW 13 74,313,956 (GRCm39) missense probably damaging 1.00
R4928:Slc9a3 UTSW 13 74,305,838 (GRCm39) missense probably damaging 1.00
R4965:Slc9a3 UTSW 13 74,312,412 (GRCm39) missense possibly damaging 0.62
R5079:Slc9a3 UTSW 13 74,312,406 (GRCm39) missense probably damaging 0.97
R5329:Slc9a3 UTSW 13 74,299,079 (GRCm39) missense possibly damaging 0.94
R5663:Slc9a3 UTSW 13 74,311,831 (GRCm39) missense probably damaging 0.98
R5876:Slc9a3 UTSW 13 74,309,842 (GRCm39) missense probably damaging 1.00
R6060:Slc9a3 UTSW 13 74,299,004 (GRCm39) missense probably damaging 1.00
R6562:Slc9a3 UTSW 13 74,303,280 (GRCm39) missense probably damaging 1.00
R6645:Slc9a3 UTSW 13 74,312,291 (GRCm39) missense probably damaging 0.99
R7145:Slc9a3 UTSW 13 74,298,797 (GRCm39) missense probably damaging 0.99
R7422:Slc9a3 UTSW 13 74,299,004 (GRCm39) missense probably damaging 1.00
R7565:Slc9a3 UTSW 13 74,305,813 (GRCm39) missense probably damaging 1.00
R7679:Slc9a3 UTSW 13 74,308,395 (GRCm39) missense possibly damaging 0.88
R8032:Slc9a3 UTSW 13 74,305,763 (GRCm39) missense probably damaging 1.00
R8080:Slc9a3 UTSW 13 74,314,146 (GRCm39) missense probably benign 0.30
R8158:Slc9a3 UTSW 13 74,303,241 (GRCm39) missense probably damaging 1.00
R8159:Slc9a3 UTSW 13 74,312,407 (GRCm39) missense probably benign 0.01
R8837:Slc9a3 UTSW 13 74,305,823 (GRCm39) missense probably damaging 1.00
R8939:Slc9a3 UTSW 13 74,311,895 (GRCm39) missense possibly damaging 0.93
R9111:Slc9a3 UTSW 13 74,298,920 (GRCm39) missense probably damaging 1.00
R9741:Slc9a3 UTSW 13 74,306,994 (GRCm39) missense possibly damaging 0.95
Z1176:Slc9a3 UTSW 13 74,313,975 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAGAGGCCTGCAATGTCATC -3'
(R):5'- TGTGACCTAAACTGAGGGAGCC -3'

Sequencing Primer
(F):5'- CCTGCAATGTCATCAGAGAAACTGG -3'
(R):5'- GCTACTACTAAGAGTGCTCCTAG -3'
Posted On 2017-02-28