Incidental Mutation 'R0568:Cnpy4'
ID 46259
Institutional Source Beutler Lab
Gene Symbol Cnpy4
Ensembl Gene ENSMUSG00000036968
Gene Name canopy FGF signaling regulator 4
Synonyms
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock # R0568 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 138187485-138193918 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 138192577 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 167 (E167G)
Ref Sequence ENSEMBL: ENSMUSP00000106559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057773] [ENSMUST00000110932] [ENSMUST00000110934]
AlphaFold Q8BQ47
Predicted Effect probably benign
Transcript: ENSMUST00000057773
SMART Domains Protein: ENSMUSP00000052869
Gene: ENSMUSG00000049285

DomainStartEndE-ValueType
Lactamase_B 70 235 4.04e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110932
AA Change: E154G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106557
Gene: ENSMUSG00000036968
AA Change: E154G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:DUF3456 32 160 9.5e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110934
AA Change: E167G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106559
Gene: ENSMUSG00000036968
AA Change: E167G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:DUF3456 43 202 3.4e-51 PFAM
low complexity region 218 230 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130126
Meta Mutation Damage Score 0.5489 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in Cnpy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02247:Cnpy4 APN 5 138192863 missense probably benign 0.00
R0317:Cnpy4 UTSW 5 138192812 nonsense probably null
R0525:Cnpy4 UTSW 5 138192616 missense probably benign 0.45
R0549:Cnpy4 UTSW 5 138187637 missense possibly damaging 0.63
R1889:Cnpy4 UTSW 5 138192840 missense probably benign 0.06
R2285:Cnpy4 UTSW 5 138192825 splice site probably null
R4272:Cnpy4 UTSW 5 138192591 missense probably damaging 0.98
R6682:Cnpy4 UTSW 5 138187722 critical splice donor site probably null
R7283:Cnpy4 UTSW 5 138192882 missense probably benign 0.00
R7787:Cnpy4 UTSW 5 138192638 missense probably benign
R8087:Cnpy4 UTSW 5 138190270 missense probably damaging 1.00
X0065:Cnpy4 UTSW 5 138192592 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACCAATGCATACTAATGTGCCTGCC -3'
(R):5'- TCCAAGCTTCCCGTAGACAAGCTG -3'

Sequencing Primer
(F):5'- gcctttcttgccgctacc -3'
(R):5'- CCGTAGACAAGCTGGGTGG -3'
Posted On 2013-06-11