Incidental Mutation 'R5919:Olfr1504'
ID462593
Institutional Source Beutler Lab
Gene Symbol Olfr1504
Ensembl Gene ENSMUSG00000059105
Gene Nameolfactory receptor 1504
SynonymsMOR212-2, GA_x6K02T2RE5P-4223635-4222688
MMRRC Submission 044116-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5919 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13886920-13897928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13887845 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 122 (Y122H)
Ref Sequence ENSEMBL: ENSMUSP00000146610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078282] [ENSMUST00000209192]
Predicted Effect probably damaging
Transcript: ENSMUST00000078282
AA Change: Y122H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077400
Gene: ENSMUSG00000059105
AA Change: Y122H

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4.3e-46 PFAM
Pfam:7tm_1 40 313 1.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209192
AA Change: Y122H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T C 1: 151,915,498 D104G probably damaging Het
2610507B11Rik A T 11: 78,289,350 N2152I probably damaging Het
6030458C11Rik A T 15: 12,823,668 H40Q probably damaging Het
Abcc3 A G 11: 94,357,306 V1156A possibly damaging Het
Adgrl1 G T 8: 83,932,610 D648Y probably damaging Het
Adgrl3 C A 5: 81,646,570 D547E probably benign Het
Aebp1 A T 11: 5,871,421 M607L probably benign Het
Angptl1 T C 1: 156,858,546 Y401H probably damaging Het
Arl4d A G 11: 101,667,136 T163A probably benign Het
Camk2b A G 11: 5,979,718 S331P probably damaging Het
Ccdc15 C T 9: 37,320,396 probably null Het
Ccdc38 A T 10: 93,578,838 I370F possibly damaging Het
Clstn1 A T 4: 149,635,246 H416L probably damaging Het
Col12a1 C T 9: 79,602,298 R3030H probably damaging Het
Cop1 T A 1: 159,319,724 V540E probably damaging Het
Crebbp C T 16: 4,108,127 R710H probably damaging Het
Dsel T C 1: 111,860,253 I851V probably benign Het
Esrp1 A G 4: 11,344,146 V642A probably damaging Het
Fam71e2 T C 7: 4,770,386 E144G possibly damaging Het
Fanci T C 7: 79,444,738 L1139P probably damaging Het
Fat1 T C 8: 45,026,873 probably null Het
Fsip2 A G 2: 82,992,609 N6229D possibly damaging Het
Gas2l3 G A 10: 89,417,055 R243W probably damaging Het
Gm7102 T C 19: 61,175,469 Y176C probably damaging Het
Gm8251 T C 1: 44,056,986 N1651D probably benign Het
Hectd1 G A 12: 51,769,072 R1406W probably damaging Het
Hecw2 T C 1: 53,937,090 H180R probably damaging Het
Ift172 T A 5: 31,260,662 Q1261L possibly damaging Het
Il17rd T C 14: 27,096,044 V230A probably damaging Het
Kif17 A T 4: 138,269,891 I42F probably damaging Het
Kif24 T C 4: 41,394,477 K799E possibly damaging Het
Lrp4 A T 2: 91,473,207 I84F probably damaging Het
Mroh7 T C 4: 106,694,312 probably null Het
Ms4a14 C A 19: 11,314,297 V13F possibly damaging Het
Muc2 T A 7: 141,694,928 V445D probably damaging Het
Muc6 A T 7: 141,641,570 M1317K possibly damaging Het
Myof T A 19: 38,024,370 D39V possibly damaging Het
Ndufaf1 A C 2: 119,660,228 V117G possibly damaging Het
Ndufs1 C G 1: 63,143,832 *728S probably null Het
Nup188 A T 2: 30,339,894 N1375Y probably damaging Het
Oasl1 T A 5: 114,928,270 I149N probably damaging Het
Pelo C A 13: 115,089,309 C204F possibly damaging Het
Phf11d A C 14: 59,356,263 probably benign Het
Rars2 T C 4: 34,657,232 L526P probably damaging Het
Rrp1 A G 10: 78,405,588 L177P probably damaging Het
S100a9 A G 3: 90,695,188 L33P probably damaging Het
Slc4a7 A G 14: 14,791,092 D1045G probably benign Het
Slc9a3 C T 13: 74,158,740 T328I probably damaging Het
Spata6 A G 4: 111,779,208 D232G probably damaging Het
Taar6 A T 10: 23,985,270 I126N probably damaging Het
Tcrg-V6 A G 13: 19,190,612 Y16C probably benign Het
Tmeff2 C A 1: 51,132,152 C182* probably null Het
Tmem178 T A 17: 80,989,758 C190S probably damaging Het
Trerf1 T G 17: 47,323,282 noncoding transcript Het
Ubn2 A G 6: 38,491,488 I1046V possibly damaging Het
Vmn1r221 A T 13: 23,217,296 noncoding transcript Het
Vmn2r2 T C 3: 64,137,302 N141S probably benign Het
Zfp64 T A 2: 168,926,499 N398Y probably benign Het
Zfp787 T G 7: 6,132,835 Q139P probably damaging Het
Other mutations in Olfr1504
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Olfr1504 APN 19 13887581 missense probably benign
IGL00885:Olfr1504 APN 19 13888168 missense probably benign 0.17
IGL01084:Olfr1504 APN 19 13887502 missense probably damaging 1.00
IGL01522:Olfr1504 APN 19 13887358 nonsense probably null
IGL01727:Olfr1504 APN 19 13887878 missense probably damaging 0.98
IGL02440:Olfr1504 APN 19 13887859 missense probably damaging 1.00
IGL03342:Olfr1504 APN 19 13887437 missense probably damaging 1.00
R0531:Olfr1504 UTSW 19 13887752 missense possibly damaging 0.62
R0577:Olfr1504 UTSW 19 13887803 missense probably damaging 1.00
R1028:Olfr1504 UTSW 19 13887795 missense probably damaging 0.97
R1674:Olfr1504 UTSW 19 13887590 missense probably benign 0.01
R3906:Olfr1504 UTSW 19 13887706 missense probably damaging 1.00
R4598:Olfr1504 UTSW 19 13888017 missense probably damaging 1.00
R4658:Olfr1504 UTSW 19 13887548 missense probably benign 0.19
R4676:Olfr1504 UTSW 19 13887401 missense probably damaging 1.00
R5943:Olfr1504 UTSW 19 13887752 missense possibly damaging 0.62
R8112:Olfr1504 UTSW 19 13887389 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGGCAAGCTTCATCAGGG -3'
(R):5'- TAATTCAGAGTGACCCTCGGC -3'

Sequencing Primer
(F):5'- CAAGCTTCATCAGGGGTGGG -3'
(R):5'- GAGTGACCCTCGGCTCCAAAC -3'
Posted On2017-02-28