Incidental Mutation 'R0568:Gna12'
ID46260
Institutional Source Beutler Lab
Gene Symbol Gna12
Ensembl Gene ENSMUSG00000000149
Gene Nameguanine nucleotide binding protein, alpha 12
SynonymsGalpha12
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.727) question?
Stock #R0568 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location140758408-140830431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140760883 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 269 (V269A)
Ref Sequence ENSEMBL: ENSMUSP00000000153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000153]
PDB Structure
Crystal structure of G alpha 12 in complex with GDP, Mg2+ and AlF4- [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000153
AA Change: V269A

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000000153
Gene: ENSMUSG00000000149
AA Change: V269A

DomainStartEndE-ValueType
G_alpha 35 378 1.07e-193 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176035
Predicted Effect unknown
Transcript: ENSMUST00000198447
AA Change: V205A
Meta Mutation Damage Score 0.1147 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Mice deficient for this gene do not exhibit any detectable abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in Gna12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Gna12 APN 5 140761018 missense probably damaging 1.00
PIT4434001:Gna12 UTSW 5 140761018 missense probably damaging 1.00
R1793:Gna12 UTSW 5 140760952 missense probably damaging 1.00
R1839:Gna12 UTSW 5 140762612 missense probably benign 0.01
R2847:Gna12 UTSW 5 140785593 missense probably damaging 1.00
R5053:Gna12 UTSW 5 140760727 missense probably benign 0.05
R5947:Gna12 UTSW 5 140760962 missense probably damaging 1.00
R6233:Gna12 UTSW 5 140760692 missense possibly damaging 0.68
R7062:Gna12 UTSW 5 140785485 missense probably benign 0.00
R7238:Gna12 UTSW 5 140830092 missense probably damaging 1.00
R7853:Gna12 UTSW 5 140760694 missense probably damaging 1.00
R7936:Gna12 UTSW 5 140760694 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCCCTTGAAATCTGGGAAGTG -3'
(R):5'- GGTTCTGACCATCCTGTCTCAAGC -3'

Sequencing Primer
(F):5'- AGTGCTTCTTAATGCTCACAGAC -3'
(R):5'- TAAGCAAGACATCCTGCTGG -3'
Posted On2013-06-11