Incidental Mutation 'R5739:Hmcn1'
ID 462604
Institutional Source Beutler Lab
Gene Symbol Hmcn1
Ensembl Gene ENSMUSG00000066842
Gene Name hemicentin 1
Synonyms LOC240793, EG545370
MMRRC Submission 043351-MU
Accession Numbers

Ncbi RefSeq: NM_001024720.3; MGI:2685047

Essential gene? Non essential (E-score: 0.000) question?
Stock # R5739 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 150562524-150993435 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 150758474 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074783] [ENSMUST00000074783] [ENSMUST00000074783] [ENSMUST00000137197] [ENSMUST00000137197] [ENSMUST00000137197]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000074783
SMART Domains Protein: ENSMUSP00000074340
Gene: ENSMUSG00000066842

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
Pfam:G2F 4869 5051 1.5e-57 PFAM
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5354 4.32e-10 SMART
low complexity region 5384 5400 N/A INTRINSIC
low complexity region 5401 5412 N/A INTRINSIC
EGF_CA 5431 5470 2.78e-13 SMART
EGF 5474 5516 1.44e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000074783
SMART Domains Protein: ENSMUSP00000074340
Gene: ENSMUSG00000066842

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
Pfam:G2F 4869 5051 1.5e-57 PFAM
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5354 4.32e-10 SMART
low complexity region 5384 5400 N/A INTRINSIC
low complexity region 5401 5412 N/A INTRINSIC
EGF_CA 5431 5470 2.78e-13 SMART
EGF 5474 5516 1.44e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000074783
SMART Domains Protein: ENSMUSP00000074340
Gene: ENSMUSG00000066842

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
Pfam:G2F 4869 5051 1.5e-57 PFAM
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5354 4.32e-10 SMART
low complexity region 5384 5400 N/A INTRINSIC
low complexity region 5401 5412 N/A INTRINSIC
EGF_CA 5431 5470 2.78e-13 SMART
EGF 5474 5516 1.44e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137197
SMART Domains Protein: ENSMUSP00000121500
Gene: ENSMUSG00000066842

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
PDB:1GL4|A 4869 5082 3e-6 PDB
SCOP:d1gl4a1 4869 5082 3e-79 SMART
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5353 2.78e-13 SMART
EGF 5357 5399 1.44e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137197
SMART Domains Protein: ENSMUSP00000121500
Gene: ENSMUSG00000066842

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
PDB:1GL4|A 4869 5082 3e-6 PDB
SCOP:d1gl4a1 4869 5082 3e-79 SMART
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5353 2.78e-13 SMART
EGF 5357 5399 1.44e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137197
SMART Domains Protein: ENSMUSP00000121500
Gene: ENSMUSG00000066842

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
PDB:1GL4|A 4869 5082 3e-6 PDB
SCOP:d1gl4a1 4869 5082 3e-79 SMART
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5353 2.78e-13 SMART
EGF 5357 5399 1.44e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177268
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large extracellular member of the immunoglobulin superfamily. A similar protein in C. elegans forms long, fine tracks at specific extracellular sites that are involved in many processes such as stabilization of the germline syncytium, anchorage of mechanosensory neurons to the epidermis, and organization of hemidesmosomes in the epidermis. Mutations in this gene may be associated with age-related macular degeneration. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,520,541 V356E possibly damaging Het
4931429L15Rik A T 9: 46,309,419 S50T probably benign Het
A930011G23Rik A G 5: 99,221,430 L529P probably damaging Het
Acer2 A T 4: 86,900,555 N147Y probably damaging Het
Adamtsl1 A G 4: 86,232,664 E353G probably damaging Het
Alg6 T C 4: 99,744,500 F60L probably benign Het
Ano6 A T 15: 95,913,379 D120V probably damaging Het
Armc3 A G 2: 19,253,917 D265G possibly damaging Het
Arntl G A 7: 113,285,031 R92Q probably damaging Het
Aurkc A T 7: 7,002,860 Y249F probably benign Het
Cacna2d2 A G 9: 107,512,329 I274V probably benign Het
Camk2n2 C A 16: 20,621,080 G39C probably damaging Het
Ccdc39 A G 3: 33,826,561 L419P possibly damaging Het
Cdh23 T C 10: 60,305,609 M3117V probably damaging Het
Celsr3 A G 9: 108,827,158 E280G probably benign Het
Cherp TGCTGGTGGTGGGG TG 8: 72,467,815 probably benign Het
Clcn6 A G 4: 148,014,189 V494A probably damaging Het
Col19a1 C T 1: 24,337,915 G450S probably damaging Het
Crb2 T G 2: 37,793,654 V1056G probably damaging Het
Crtac1 A G 19: 42,302,173 F363S probably damaging Het
Dnaaf2 T C 12: 69,196,941 S449G probably benign Het
Dnah7b A T 1: 46,233,992 I2427F probably damaging Het
Dnah8 T A 17: 30,719,007 D1619E probably benign Het
Dock3 A T 9: 106,973,796 S836T possibly damaging Het
Donson A T 16: 91,681,229 probably null Het
Drc3 G A 11: 60,375,130 R215H possibly damaging Het
Entpd2 T C 2: 25,399,492 S329P possibly damaging Het
Eya2 T C 2: 165,761,937 S332P probably damaging Het
Fam83f T A 15: 80,692,005 Y286N probably damaging Het
Fat4 T C 3: 38,983,134 V3645A probably benign Het
G2e3 T C 12: 51,372,504 F668L possibly damaging Het
Gm14403 T A 2: 177,509,247 C329S probably damaging Het
Hrnr T C 3: 93,323,129 S225P unknown Het
Ifi202b C T 1: 173,971,352 probably null Het
Il10ra A T 9: 45,256,070 D394E possibly damaging Het
Itga2b A T 11: 102,465,909 D275E probably benign Het
Jaml A T 9: 45,088,728 D108V probably damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrrtm1 T C 6: 77,244,889 V443A probably damaging Het
Mkln1 T A 6: 31,496,702 S126R probably benign Het
Myo19 T C 11: 84,897,624 I354T probably damaging Het
Nucb1 A T 7: 45,501,660 L99Q probably damaging Het
Olfr1312 A G 2: 112,042,783 F83S probably damaging Het
Pask A G 1: 93,322,056 S541P probably benign Het
Pdpr A T 8: 111,134,620 I749F possibly damaging Het
Phyhipl T C 10: 70,559,569 D269G possibly damaging Het
Pkdcc A G 17: 83,215,794 D110G probably benign Het
Ppox A G 1: 171,279,996 L115P probably damaging Het
Ppp1r12c A G 7: 4,497,282 L94P probably damaging Het
Ppp6r2 T A 15: 89,259,073 M141K probably benign Het
Prl3d1 A T 13: 27,100,012 H188L probably benign Het
Psmb3 T A 11: 97,713,470 probably benign Het
Pxdn T A 12: 29,982,334 S150T probably benign Het
Ripor3 T C 2: 167,981,283 T903A probably damaging Het
Rnase4 T C 14: 51,104,849 L10S probably benign Het
Rnf224 T C 2: 25,236,000 T114A probably benign Het
Rp1l1 A T 14: 64,032,170 E1735V probably benign Het
Rrp1b T A 17: 32,045,976 Y60N probably damaging Het
Rsbn1l A T 5: 20,905,816 V508E probably damaging Het
Rubcnl T C 14: 75,040,941 probably null Het
Rxfp4 A G 3: 88,651,902 probably benign Het
Sdccag8 A G 1: 176,826,231 T85A probably benign Het
Slc46a1 A T 11: 78,467,149 I343F possibly damaging Het
Ssh2 A G 11: 77,449,813 D597G probably damaging Het
Syne2 T A 12: 75,997,465 V3942E possibly damaging Het
Timd4 T C 11: 46,817,746 S200P probably benign Het
Tmc5 G A 7: 118,666,611 probably null Het
Tmem8 T A 17: 26,120,451 F580I probably damaging Het
Trbv16 A G 6: 41,152,079 T66A probably benign Het
Ttc3 A T 16: 94,439,324 K1103* probably null Het
Ttc7b A G 12: 100,384,233 V458A probably damaging Het
Ubxn10 A G 4: 138,720,823 S181P probably benign Het
Vmn2r11 A G 5: 109,059,248 probably null Het
Vmn2r26 A T 6: 124,025,966 N112Y probably benign Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Zc3h10 T C 10: 128,544,801 N229S probably benign Het
Zfp407 T C 18: 84,208,742 *2247W probably null Het
Zfyve1 C A 12: 83,575,136 V162L possibly damaging Het
Other mutations in Hmcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Hmcn1 APN 1 150677278 missense probably benign
IGL00571:Hmcn1 APN 1 150638999 missense probably benign 0.05
IGL00726:Hmcn1 APN 1 150806366 critical splice donor site probably null
IGL00802:Hmcn1 APN 1 150664936 missense probably benign 0.19
IGL00824:Hmcn1 APN 1 150656734 missense probably damaging 1.00
IGL00834:Hmcn1 APN 1 150630340 missense probably benign 0.00
IGL00843:Hmcn1 APN 1 150610713 missense possibly damaging 0.95
IGL00845:Hmcn1 APN 1 150605006 missense probably damaging 0.98
IGL00851:Hmcn1 APN 1 150582301 missense probably benign 0.02
IGL00909:Hmcn1 APN 1 150638869 missense probably benign 0.12
IGL01074:Hmcn1 APN 1 150627033 missense possibly damaging 0.82
IGL01112:Hmcn1 APN 1 150632552 splice site probably benign
IGL01304:Hmcn1 APN 1 150622924 missense probably damaging 0.99
IGL01307:Hmcn1 APN 1 150745001 missense possibly damaging 0.84
IGL01318:Hmcn1 APN 1 150719240 missense probably damaging 1.00
IGL01403:Hmcn1 APN 1 150593097 missense probably damaging 1.00
IGL01417:Hmcn1 APN 1 150859239 missense probably damaging 1.00
IGL01503:Hmcn1 APN 1 150605072 missense probably benign 0.38
IGL01509:Hmcn1 APN 1 150609631 missense probably damaging 1.00
IGL01550:Hmcn1 APN 1 150598397 missense probably damaging 1.00
IGL01601:Hmcn1 APN 1 150627413 missense probably benign 0.01
IGL01617:Hmcn1 APN 1 150672032 missense probably benign 0.05
IGL01636:Hmcn1 APN 1 150580233 missense probably damaging 1.00
IGL01662:Hmcn1 APN 1 150737299 missense possibly damaging 0.46
IGL01693:Hmcn1 APN 1 150583280 missense probably damaging 1.00
IGL01723:Hmcn1 APN 1 150744960 missense probably benign 0.01
IGL01776:Hmcn1 APN 1 150672038 missense possibly damaging 0.70
IGL01783:Hmcn1 APN 1 150615300 missense possibly damaging 0.60
IGL01789:Hmcn1 APN 1 150690601 missense probably damaging 1.00
IGL01900:Hmcn1 APN 1 150742260 splice site probably benign
IGL01906:Hmcn1 APN 1 150667887 missense probably benign 0.01
IGL01947:Hmcn1 APN 1 150732892 missense possibly damaging 0.93
IGL01958:Hmcn1 APN 1 150603871 missense probably benign 0.01
IGL02002:Hmcn1 APN 1 150615298 missense probably damaging 1.00
IGL02058:Hmcn1 APN 1 150704181 missense probably benign 0.02
IGL02115:Hmcn1 APN 1 150630728 missense probably damaging 1.00
IGL02127:Hmcn1 APN 1 150722607 missense probably benign
IGL02155:Hmcn1 APN 1 150563598 missense probably damaging 1.00
IGL02222:Hmcn1 APN 1 150806401 missense probably benign 0.05
IGL02293:Hmcn1 APN 1 150664915 missense probably damaging 0.97
IGL02398:Hmcn1 APN 1 150802897 missense possibly damaging 0.78
IGL02420:Hmcn1 APN 1 150722424 missense probably damaging 1.00
IGL02553:Hmcn1 APN 1 150993023 missense probably benign 0.12
IGL02561:Hmcn1 APN 1 150809726 missense probably benign 0.32
IGL02569:Hmcn1 APN 1 150697493 missense probably benign 0.01
IGL02607:Hmcn1 APN 1 150744995 missense possibly damaging 0.88
IGL02676:Hmcn1 APN 1 150619009 missense probably benign 0.01
IGL02725:Hmcn1 APN 1 150604903 missense possibly damaging 0.92
IGL02726:Hmcn1 APN 1 150656694 nonsense probably null
IGL02735:Hmcn1 APN 1 150646832 missense probably benign 0.02
IGL02737:Hmcn1 APN 1 150563828 missense probably damaging 1.00
IGL02892:Hmcn1 APN 1 150675974 critical splice donor site probably null
IGL02927:Hmcn1 APN 1 150577278 missense probably damaging 1.00
IGL02931:Hmcn1 APN 1 150657207 missense probably benign 0.37
IGL02936:Hmcn1 APN 1 150697522 missense probably damaging 0.98
IGL02985:Hmcn1 APN 1 150671917 missense probably damaging 1.00
IGL03027:Hmcn1 APN 1 150808539 missense probably benign
IGL03195:Hmcn1 APN 1 150802909 missense probably benign 0.06
IGL03217:Hmcn1 APN 1 150743667 missense possibly damaging 0.58
IGL03232:Hmcn1 APN 1 150770352 splice site probably benign
IGL03268:Hmcn1 APN 1 150772510 missense probably damaging 1.00
IGL03271:Hmcn1 APN 1 150598424 missense possibly damaging 0.92
IGL03304:Hmcn1 APN 1 150630231 missense probably damaging 0.97
IGL03329:Hmcn1 APN 1 150732910 missense probably damaging 1.00
IGL03339:Hmcn1 APN 1 150701969 missense probably benign 0.04
IGL03368:Hmcn1 APN 1 150663872 missense probably damaging 1.00
Backbone UTSW 1 150622994 missense probably benign 0.09
Cambrian UTSW 1 150732846 missense probably damaging 1.00
chordate UTSW 1 150587015 missense probably benign 0.00
Justamere UTSW 1 150588257 missense probably damaging 1.00
Lancelet UTSW 1 150675540 missense probably benign 0.00
notochord UTSW 1 150770293 missense probably benign 0.00
wippoorwill UTSW 1 150732946 missense probably damaging 1.00
BB004:Hmcn1 UTSW 1 150609775 missense probably damaging 1.00
BB014:Hmcn1 UTSW 1 150609775 missense probably damaging 1.00
IGL02991:Hmcn1 UTSW 1 150738658 missense possibly damaging 0.56
P0017:Hmcn1 UTSW 1 150720689 missense possibly damaging 0.49
PIT1430001:Hmcn1 UTSW 1 150808737 missense probably benign 0.00
PIT4514001:Hmcn1 UTSW 1 150669487 missense possibly damaging 0.93
R0006:Hmcn1 UTSW 1 150808676 missense probably damaging 0.99
R0018:Hmcn1 UTSW 1 150652551 missense probably benign 0.16
R0052:Hmcn1 UTSW 1 150677406 missense probably damaging 1.00
R0107:Hmcn1 UTSW 1 150587015 missense probably benign 0.00
R0115:Hmcn1 UTSW 1 150808647 missense possibly damaging 0.88
R0149:Hmcn1 UTSW 1 150677324 missense probably benign 0.00
R0152:Hmcn1 UTSW 1 150663879 missense probably benign 0.01
R0381:Hmcn1 UTSW 1 150603811 missense probably damaging 1.00
R0398:Hmcn1 UTSW 1 150798814 missense possibly damaging 0.83
R0414:Hmcn1 UTSW 1 150715822 missense possibly damaging 0.72
R0494:Hmcn1 UTSW 1 150732792 splice site probably benign
R0503:Hmcn1 UTSW 1 150859252 missense probably damaging 1.00
R0504:Hmcn1 UTSW 1 150876419 splice site probably benign
R0506:Hmcn1 UTSW 1 150742341 missense possibly damaging 0.69
R0554:Hmcn1 UTSW 1 150719117 missense probably benign 0.34
R0576:Hmcn1 UTSW 1 150650017 nonsense probably null
R0599:Hmcn1 UTSW 1 150609801 missense possibly damaging 0.91
R0605:Hmcn1 UTSW 1 150657376 critical splice donor site probably null
R0607:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R0620:Hmcn1 UTSW 1 150594016 missense probably benign 0.04
R0626:Hmcn1 UTSW 1 150798719 splice site probably null
R0699:Hmcn1 UTSW 1 150819410 missense probably damaging 1.00
R0765:Hmcn1 UTSW 1 150808787 missense probably damaging 1.00
R0782:Hmcn1 UTSW 1 150753665 missense possibly damaging 0.82
R0783:Hmcn1 UTSW 1 150650073 missense probably damaging 1.00
R0841:Hmcn1 UTSW 1 150679607 splice site probably null
R0975:Hmcn1 UTSW 1 150577377 missense probably benign 0.00
R1070:Hmcn1 UTSW 1 150689590 missense probably damaging 0.98
R1118:Hmcn1 UTSW 1 150618928 missense possibly damaging 0.56
R1119:Hmcn1 UTSW 1 150618928 missense possibly damaging 0.56
R1145:Hmcn1 UTSW 1 150679607 splice site probably null
R1145:Hmcn1 UTSW 1 150679607 splice site probably null
R1233:Hmcn1 UTSW 1 150749026 missense probably benign
R1234:Hmcn1 UTSW 1 150753654 nonsense probably null
R1291:Hmcn1 UTSW 1 150748191 missense probably damaging 1.00
R1334:Hmcn1 UTSW 1 150586468 missense possibly damaging 0.73
R1372:Hmcn1 UTSW 1 150680715 missense probably benign 0.22
R1424:Hmcn1 UTSW 1 150646794 missense probably benign 0.00
R1450:Hmcn1 UTSW 1 150652506 splice site probably benign
R1458:Hmcn1 UTSW 1 150609700 missense probably damaging 1.00
R1467:Hmcn1 UTSW 1 150689590 missense probably damaging 0.98
R1467:Hmcn1 UTSW 1 150689590 missense probably damaging 0.98
R1473:Hmcn1 UTSW 1 150772552 missense probably benign 0.03
R1517:Hmcn1 UTSW 1 150669421 missense probably damaging 1.00
R1527:Hmcn1 UTSW 1 150773803 missense probably benign 0.00
R1557:Hmcn1 UTSW 1 150734532 missense possibly damaging 0.86
R1576:Hmcn1 UTSW 1 150657241 missense possibly damaging 0.77
R1617:Hmcn1 UTSW 1 150745027 missense probably damaging 0.98
R1635:Hmcn1 UTSW 1 150669558 missense probably benign 0.00
R1655:Hmcn1 UTSW 1 150630333 missense probably benign 0.03
R1698:Hmcn1 UTSW 1 150565369 nonsense probably null
R1710:Hmcn1 UTSW 1 150675984 missense probably damaging 1.00
R1717:Hmcn1 UTSW 1 150859186 missense probably damaging 1.00
R1753:Hmcn1 UTSW 1 150586468 missense possibly damaging 0.73
R1756:Hmcn1 UTSW 1 150599030 missense probably damaging 1.00
R1772:Hmcn1 UTSW 1 150563568 missense probably damaging 0.99
R1793:Hmcn1 UTSW 1 150749083 missense probably benign 0.01
R1794:Hmcn1 UTSW 1 150598285 missense probably benign 0.00
R1794:Hmcn1 UTSW 1 150627152 missense probably damaging 0.98
R1856:Hmcn1 UTSW 1 150721664 missense probably benign 0.02
R1859:Hmcn1 UTSW 1 150657193 missense probably damaging 1.00
R1862:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R1865:Hmcn1 UTSW 1 150603812 missense probably damaging 1.00
R1874:Hmcn1 UTSW 1 150720695 missense probably damaging 1.00
R1880:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R1881:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R1886:Hmcn1 UTSW 1 150577295 missense probably benign 0.02
R1888:Hmcn1 UTSW 1 150819500 missense possibly damaging 0.82
R1888:Hmcn1 UTSW 1 150819500 missense possibly damaging 0.82
R1899:Hmcn1 UTSW 1 150657451 missense probably damaging 1.00
R1905:Hmcn1 UTSW 1 150992855 missense probably damaging 1.00
R1912:Hmcn1 UTSW 1 150604882 missense probably benign 0.28
R1959:Hmcn1 UTSW 1 150649676 missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150675991 missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150677376 missense possibly damaging 0.72
R2001:Hmcn1 UTSW 1 150738613 missense possibly damaging 0.81
R2011:Hmcn1 UTSW 1 150677334 missense probably benign 0.01
R2075:Hmcn1 UTSW 1 150577323 missense possibly damaging 0.86
R2136:Hmcn1 UTSW 1 150633659 missense probably damaging 1.00
R2192:Hmcn1 UTSW 1 150715815 missense probably damaging 0.97
R2267:Hmcn1 UTSW 1 150599010 missense probably benign 0.00
R2268:Hmcn1 UTSW 1 150624598 splice site probably benign
R2303:Hmcn1 UTSW 1 150704226 missense probably damaging 1.00
R2330:Hmcn1 UTSW 1 150652678 splice site probably benign
R2338:Hmcn1 UTSW 1 150622934 missense possibly damaging 0.89
R2380:Hmcn1 UTSW 1 150565384 missense probably benign 0.01
R2405:Hmcn1 UTSW 1 150860341 missense probably damaging 1.00
R2443:Hmcn1 UTSW 1 150599032 missense probably benign 0.01
R2496:Hmcn1 UTSW 1 150615221 missense probably benign 0.01
R2504:Hmcn1 UTSW 1 150686867 nonsense probably null
R2519:Hmcn1 UTSW 1 150773820 nonsense probably null
R2520:Hmcn1 UTSW 1 150743647 missense possibly damaging 0.72
R2679:Hmcn1 UTSW 1 150652575 missense possibly damaging 0.67
R2831:Hmcn1 UTSW 1 150630652 critical splice donor site probably null
R2847:Hmcn1 UTSW 1 150563599 nonsense probably null
R2849:Hmcn1 UTSW 1 150563599 nonsense probably null
R2869:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2869:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2873:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2897:Hmcn1 UTSW 1 150802873 missense probably damaging 1.00
R2905:Hmcn1 UTSW 1 150749035 missense probably damaging 1.00
R3498:Hmcn1 UTSW 1 150605102 missense probably damaging 0.98
R3499:Hmcn1 UTSW 1 150605102 missense probably damaging 0.98
R3724:Hmcn1 UTSW 1 150689518 missense possibly damaging 0.82
R3765:Hmcn1 UTSW 1 150745025 missense possibly damaging 0.72
R3778:Hmcn1 UTSW 1 150802824 missense possibly damaging 0.95
R3790:Hmcn1 UTSW 1 150622994 missense probably benign 0.09
R3796:Hmcn1 UTSW 1 150586418 missense probably damaging 1.00
R3811:Hmcn1 UTSW 1 150649577 critical splice donor site probably null
R3825:Hmcn1 UTSW 1 150586965 missense probably benign 0.28
R3890:Hmcn1 UTSW 1 150635195 missense probably damaging 1.00
R3891:Hmcn1 UTSW 1 150635195 missense probably damaging 1.00
R3892:Hmcn1 UTSW 1 150635195 missense probably damaging 1.00
R3918:Hmcn1 UTSW 1 150690610 missense probably benign 0.00
R3964:Hmcn1 UTSW 1 150573569 missense probably benign 0.00
R4005:Hmcn1 UTSW 1 150722453 missense possibly damaging 0.88
R4026:Hmcn1 UTSW 1 150722369 missense probably benign 0.03
R4037:Hmcn1 UTSW 1 150772502 missense probably benign 0.00
R4088:Hmcn1 UTSW 1 150703216 missense possibly damaging 0.58
R4096:Hmcn1 UTSW 1 150658508 missense probably benign 0.20
R4169:Hmcn1 UTSW 1 150595999 splice site probably null
R4441:Hmcn1 UTSW 1 150657459 missense probably null
R4493:Hmcn1 UTSW 1 150701899 missense probably damaging 1.00
R4501:Hmcn1 UTSW 1 150633666 missense probably damaging 1.00
R4535:Hmcn1 UTSW 1 150563780 missense probably damaging 0.99
R4576:Hmcn1 UTSW 1 150734487 missense probably benign
R4601:Hmcn1 UTSW 1 150738645 missense probably damaging 0.99
R4627:Hmcn1 UTSW 1 150595894 missense probably benign 0.11
R4647:Hmcn1 UTSW 1 150675511 critical splice donor site probably null
R4657:Hmcn1 UTSW 1 150624550 missense probably damaging 1.00
R4717:Hmcn1 UTSW 1 150619065 missense probably benign 0.00
R4721:Hmcn1 UTSW 1 150772571 splice site probably null
R4724:Hmcn1 UTSW 1 150694833 splice site probably null
R4737:Hmcn1 UTSW 1 150689595 missense possibly damaging 0.90
R4744:Hmcn1 UTSW 1 150577612 missense probably damaging 1.00
R4795:Hmcn1 UTSW 1 150753611 missense probably benign 0.00
R4796:Hmcn1 UTSW 1 150753611 missense probably benign 0.00
R4871:Hmcn1 UTSW 1 150593085 missense probably benign 0.02
R4895:Hmcn1 UTSW 1 150677379 missense probably benign 0.00
R4934:Hmcn1 UTSW 1 150722535 missense probably damaging 1.00
R4953:Hmcn1 UTSW 1 150876360 intron probably benign
R4968:Hmcn1 UTSW 1 150657470 missense possibly damaging 0.67
R4974:Hmcn1 UTSW 1 150819449 missense probably benign 0.01
R5024:Hmcn1 UTSW 1 150680688 missense possibly damaging 0.65
R5031:Hmcn1 UTSW 1 150588257 missense probably damaging 1.00
R5093:Hmcn1 UTSW 1 150737256 missense probably benign 0.14
R5096:Hmcn1 UTSW 1 150610669 missense probably damaging 1.00
R5185:Hmcn1 UTSW 1 150656741 missense probably benign 0.03
R5228:Hmcn1 UTSW 1 150646701 missense probably benign 0.00
R5260:Hmcn1 UTSW 1 150595861 missense possibly damaging 0.65
R5264:Hmcn1 UTSW 1 150679514 missense probably benign 0.01
R5282:Hmcn1 UTSW 1 150582296 missense probably damaging 1.00
R5334:Hmcn1 UTSW 1 150755372 missense probably damaging 0.99
R5346:Hmcn1 UTSW 1 150623244 missense probably damaging 1.00
R5423:Hmcn1 UTSW 1 150701972 missense probably damaging 1.00
R5484:Hmcn1 UTSW 1 150675540 missense probably benign 0.00
R5491:Hmcn1 UTSW 1 150609825 splice site probably null
R5531:Hmcn1 UTSW 1 150743788 missense probably damaging 1.00
R5536:Hmcn1 UTSW 1 150755291 missense probably benign 0.01
R5547:Hmcn1 UTSW 1 150737506 missense possibly damaging 0.64
R5580:Hmcn1 UTSW 1 150577539 missense probably benign 0.43
R5626:Hmcn1 UTSW 1 150656567 missense probably damaging 1.00
R5657:Hmcn1 UTSW 1 150658562 missense probably benign 0.02
R5677:Hmcn1 UTSW 1 150609778 missense probably benign 0.00
R5718:Hmcn1 UTSW 1 150609666 missense probably damaging 1.00
R5718:Hmcn1 UTSW 1 150690600 nonsense probably null
R5723:Hmcn1 UTSW 1 150694849 missense possibly damaging 0.95
R5739:Hmcn1 UTSW 1 150808697 missense probably benign 0.45
R5751:Hmcn1 UTSW 1 150573554 missense probably damaging 1.00
R5772:Hmcn1 UTSW 1 150694878 missense possibly damaging 0.47
R5804:Hmcn1 UTSW 1 150674347 nonsense probably null
R5809:Hmcn1 UTSW 1 150649607 missense probably damaging 1.00
R5817:Hmcn1 UTSW 1 150737524 missense possibly damaging 0.77
R5824:Hmcn1 UTSW 1 150993023 missense probably benign 0.12
R5881:Hmcn1 UTSW 1 150630327 missense probably damaging 0.99
R5928:Hmcn1 UTSW 1 150598897 missense possibly damaging 0.64
R5929:Hmcn1 UTSW 1 150577296 nonsense probably null
R5940:Hmcn1 UTSW 1 150657222 missense probably benign 0.41
R5973:Hmcn1 UTSW 1 150563817 missense probably damaging 1.00
R5997:Hmcn1 UTSW 1 150704173 missense possibly damaging 0.74
R6027:Hmcn1 UTSW 1 150802895 missense possibly damaging 0.79
R6029:Hmcn1 UTSW 1 150632437 missense probably benign 0.13
R6056:Hmcn1 UTSW 1 150663909 missense probably damaging 1.00
R6065:Hmcn1 UTSW 1 150770330 missense probably benign 0.06
R6083:Hmcn1 UTSW 1 150755293 missense probably damaging 1.00
R6083:Hmcn1 UTSW 1 150755294 missense probably damaging 1.00
R6108:Hmcn1 UTSW 1 150631227 missense possibly damaging 0.95
R6112:Hmcn1 UTSW 1 150618936 missense probably damaging 1.00
R6140:Hmcn1 UTSW 1 150732846 missense probably damaging 1.00
R6144:Hmcn1 UTSW 1 150722424 missense probably damaging 1.00
R6152:Hmcn1 UTSW 1 150565425 missense probably damaging 1.00
R6174:Hmcn1 UTSW 1 150646784 missense probably benign 0.06
R6185:Hmcn1 UTSW 1 150615438 splice site probably null
R6187:Hmcn1 UTSW 1 150630728 missense probably damaging 1.00
R6276:Hmcn1 UTSW 1 150738681 missense possibly damaging 0.69
R6278:Hmcn1 UTSW 1 150697419 critical splice donor site probably null
R6427:Hmcn1 UTSW 1 150697476 missense possibly damaging 0.85
R6431:Hmcn1 UTSW 1 150744960 missense probably benign 0.01
R6441:Hmcn1 UTSW 1 150703216 missense possibly damaging 0.58
R6451:Hmcn1 UTSW 1 150992919 missense probably damaging 1.00
R6478:Hmcn1 UTSW 1 150664784 missense probably damaging 1.00
R6479:Hmcn1 UTSW 1 150677302 nonsense probably null
R6490:Hmcn1 UTSW 1 150583278 missense probably benign 0.00
R6525:Hmcn1 UTSW 1 150697566 missense probably damaging 1.00
R6571:Hmcn1 UTSW 1 150615438 splice site probably null
R6612:Hmcn1 UTSW 1 150595118 critical splice donor site probably null
R6616:Hmcn1 UTSW 1 150723257 critical splice donor site probably null
R6617:Hmcn1 UTSW 1 150743796 missense probably benign 0.01
R6623:Hmcn1 UTSW 1 150758306 missense probably benign
R6687:Hmcn1 UTSW 1 150745033 missense probably benign 0.30
R6714:Hmcn1 UTSW 1 150704175 missense probably damaging 0.97
R6751:Hmcn1 UTSW 1 150734518 missense probably damaging 0.98
R6831:Hmcn1 UTSW 1 150770293 missense probably benign 0.00
R6971:Hmcn1 UTSW 1 150993051 start codon destroyed probably benign 0.00
R7048:Hmcn1 UTSW 1 150599653 critical splice acceptor site probably null
R7058:Hmcn1 UTSW 1 150773890 missense probably benign 0.43
R7071:Hmcn1 UTSW 1 150604102 missense probably damaging 1.00
R7078:Hmcn1 UTSW 1 150860367 missense probably damaging 1.00
R7092:Hmcn1 UTSW 1 150604246 missense probably damaging 1.00
R7120:Hmcn1 UTSW 1 150700541 missense probably damaging 0.98
R7129:Hmcn1 UTSW 1 150577210 splice site probably null
R7144:Hmcn1 UTSW 1 150663873 missense probably damaging 1.00
R7148:Hmcn1 UTSW 1 150686854 missense probably benign 0.00
R7162:Hmcn1 UTSW 1 150748993 missense probably benign 0.18
R7172:Hmcn1 UTSW 1 150753699 missense possibly damaging 0.92
R7193:Hmcn1 UTSW 1 150649580 missense probably null 1.00
R7231:Hmcn1 UTSW 1 150638876 missense probably benign 0.00
R7237:Hmcn1 UTSW 1 150722643 missense probably damaging 0.98
R7258:Hmcn1 UTSW 1 150715823 missense probably benign 0.12
R7286:Hmcn1 UTSW 1 150582337 missense probably damaging 0.98
R7289:Hmcn1 UTSW 1 150683715 missense possibly damaging 0.52
R7292:Hmcn1 UTSW 1 150733129 splice site probably null
R7316:Hmcn1 UTSW 1 150732946 missense probably damaging 1.00
R7327:Hmcn1 UTSW 1 150603814 missense probably benign 0.01
R7328:Hmcn1 UTSW 1 150638866 missense possibly damaging 0.95
R7346:Hmcn1 UTSW 1 150683745 missense probably damaging 1.00
R7351:Hmcn1 UTSW 1 150667889 missense probably damaging 0.98
R7354:Hmcn1 UTSW 1 150806445 nonsense probably null
R7360:Hmcn1 UTSW 1 150618846 missense probably damaging 1.00
R7396:Hmcn1 UTSW 1 150563631 missense possibly damaging 0.83
R7398:Hmcn1 UTSW 1 150646670 missense probably benign 0.00
R7400:Hmcn1 UTSW 1 150674430 missense probably damaging 1.00
R7404:Hmcn1 UTSW 1 150720759 missense probably benign 0.00
R7424:Hmcn1 UTSW 1 150630266 nonsense probably null
R7454:Hmcn1 UTSW 1 150563604 missense probably damaging 1.00
R7476:Hmcn1 UTSW 1 150580267 missense probably damaging 0.99
R7480:Hmcn1 UTSW 1 150677234 critical splice donor site probably null
R7516:Hmcn1 UTSW 1 150622967 missense probably benign 0.35
R7526:Hmcn1 UTSW 1 150656573 missense probably damaging 1.00
R7531:Hmcn1 UTSW 1 150686780 missense probably benign 0.06
R7555:Hmcn1 UTSW 1 150604874 missense probably benign 0.40
R7564:Hmcn1 UTSW 1 150655835 missense probably benign
R7588:Hmcn1 UTSW 1 150657134 missense possibly damaging 0.90
R7719:Hmcn1 UTSW 1 150565329 missense possibly damaging 0.95
R7720:Hmcn1 UTSW 1 150646709 missense probably benign 0.00
R7722:Hmcn1 UTSW 1 150667880 missense probably damaging 0.98
R7761:Hmcn1 UTSW 1 150722445 missense possibly damaging 0.70
R7787:Hmcn1 UTSW 1 150756592 missense probably damaging 1.00
R7803:Hmcn1 UTSW 1 150770279 missense probably benign 0.32
R7862:Hmcn1 UTSW 1 150806421 missense probably damaging 0.96
R7876:Hmcn1 UTSW 1 150744971 missense probably benign 0.03
R7886:Hmcn1 UTSW 1 150657470 missense possibly damaging 0.94
R7891:Hmcn1 UTSW 1 150593189 missense probably damaging 1.00
R7892:Hmcn1 UTSW 1 150664892 missense probably benign 0.00
R7927:Hmcn1 UTSW 1 150609775 missense probably damaging 1.00
R7941:Hmcn1 UTSW 1 150650084 missense possibly damaging 0.95
R7960:Hmcn1 UTSW 1 150655855 missense probably damaging 1.00
R8001:Hmcn1 UTSW 1 150664878 nonsense probably null
R8015:Hmcn1 UTSW 1 150598311 missense possibly damaging 0.83
R8070:Hmcn1 UTSW 1 150649992 nonsense probably null
R8072:Hmcn1 UTSW 1 150656505 missense possibly damaging 0.62
R8113:Hmcn1 UTSW 1 150749090 missense possibly damaging 0.50
R8143:Hmcn1 UTSW 1 150859206 missense probably benign 0.03
R8145:Hmcn1 UTSW 1 150753660 missense probably benign 0.33
R8155:Hmcn1 UTSW 1 150604954 missense probably damaging 1.00
R8165:Hmcn1 UTSW 1 150646658 missense probably benign 0.09
R8179:Hmcn1 UTSW 1 150722514 missense probably benign 0.19
R8193:Hmcn1 UTSW 1 150577477 nonsense probably null
R8234:Hmcn1 UTSW 1 150594010 missense possibly damaging 0.83
R8249:Hmcn1 UTSW 1 150819366 missense probably benign 0.24
R8267:Hmcn1 UTSW 1 150859254 missense probably damaging 1.00
R8312:Hmcn1 UTSW 1 150738764 missense probably damaging 0.99
R8338:Hmcn1 UTSW 1 150738734 missense probably benign 0.35
R8354:Hmcn1 UTSW 1 150758391 missense possibly damaging 0.79
R8440:Hmcn1 UTSW 1 150694920 missense probably damaging 1.00
R8473:Hmcn1 UTSW 1 150603800 missense possibly damaging 0.64
R8497:Hmcn1 UTSW 1 150580239 missense probably benign 0.01
R8509:Hmcn1 UTSW 1 150573551 nonsense probably null
R8559:Hmcn1 UTSW 1 150676038 missense probably benign 0.25
R8701:Hmcn1 UTSW 1 150755257 missense probably benign 0.00
R8755:Hmcn1 UTSW 1 150633620 missense probably benign 0.19
R8765:Hmcn1 UTSW 1 150680662 missense probably damaging 0.98
R8782:Hmcn1 UTSW 1 150664885 missense probably benign 0.08
R8794:Hmcn1 UTSW 1 150715718 missense probably benign 0.00
R8803:Hmcn1 UTSW 1 150734497 missense probably damaging 1.00
R8808:Hmcn1 UTSW 1 150655819 missense possibly damaging 0.64
R8853:Hmcn1 UTSW 1 150671975 missense probably damaging 1.00
R8877:Hmcn1 UTSW 1 150638908 missense probably benign 0.00
R8881:Hmcn1 UTSW 1 150649972 missense probably damaging 1.00
R8916:Hmcn1 UTSW 1 150773779 missense probably damaging 1.00
R9008:Hmcn1 UTSW 1 150755044 intron probably benign
R9030:Hmcn1 UTSW 1 150817119 missense probably benign 0.00
R9072:Hmcn1 UTSW 1 150689569 missense probably benign 0.04
R9090:Hmcn1 UTSW 1 150756558 missense probably damaging 1.00
R9096:Hmcn1 UTSW 1 150657118 missense probably benign 0.04
R9102:Hmcn1 UTSW 1 150697580 missense probably benign 0.01
R9146:Hmcn1 UTSW 1 150598390 missense probably benign 0.02
R9157:Hmcn1 UTSW 1 150646592 missense probably benign 0.06
R9169:Hmcn1 UTSW 1 150630341 missense probably damaging 0.99
R9182:Hmcn1 UTSW 1 150612654 missense probably damaging 1.00
R9182:Hmcn1 UTSW 1 150624586 nonsense probably null
R9204:Hmcn1 UTSW 1 150734511 missense probably benign 0.40
R9219:Hmcn1 UTSW 1 150719093 critical splice donor site probably null
R9267:Hmcn1 UTSW 1 150597989 missense probably benign 0.26
R9271:Hmcn1 UTSW 1 150756558 missense probably damaging 1.00
R9274:Hmcn1 UTSW 1 150630295 missense probably benign 0.01
R9313:Hmcn1 UTSW 1 150646592 missense probably benign 0.06
R9414:Hmcn1 UTSW 1 150669436 missense probably damaging 1.00
R9456:Hmcn1 UTSW 1 150630302 nonsense probably null
R9464:Hmcn1 UTSW 1 150723497 missense possibly damaging 0.80
R9474:Hmcn1 UTSW 1 150630720 missense probably damaging 1.00
R9476:Hmcn1 UTSW 1 150586376 missense probably benign 0.00
R9482:Hmcn1 UTSW 1 150734530 missense probably benign 0.06
R9496:Hmcn1 UTSW 1 150704220 missense probably benign 0.00
R9501:Hmcn1 UTSW 1 150595239 missense possibly damaging 0.67
R9510:Hmcn1 UTSW 1 150586376 missense probably benign 0.00
R9529:Hmcn1 UTSW 1 150669424 missense probably damaging 1.00
R9566:Hmcn1 UTSW 1 150622909 missense probably benign 0.00
R9608:Hmcn1 UTSW 1 150599552 missense probably damaging 1.00
R9609:Hmcn1 UTSW 1 150679595 missense probably damaging 0.96
R9616:Hmcn1 UTSW 1 150808722 missense probably benign 0.16
R9627:Hmcn1 UTSW 1 150630303 missense probably damaging 1.00
R9668:Hmcn1 UTSW 1 150743741 missense probably benign 0.02
R9686:Hmcn1 UTSW 1 150737605 missense probably damaging 0.99
R9717:Hmcn1 UTSW 1 150609627 missense probably damaging 1.00
R9727:Hmcn1 UTSW 1 150798815 missense probably benign 0.06
R9744:Hmcn1 UTSW 1 150748190 missense probably damaging 1.00
R9749:Hmcn1 UTSW 1 150756588 missense possibly damaging 0.94
R9761:Hmcn1 UTSW 1 150992874 missense probably damaging 0.98
R9783:Hmcn1 UTSW 1 150722629 missense probably benign 0.16
R9788:Hmcn1 UTSW 1 150652582 missense probably benign 0.00
R9792:Hmcn1 UTSW 1 150732938 missense possibly damaging 0.94
R9793:Hmcn1 UTSW 1 150732938 missense possibly damaging 0.94
R9795:Hmcn1 UTSW 1 150732938 missense possibly damaging 0.94
R9802:Hmcn1 UTSW 1 150808640 missense probably benign 0.07
RF003:Hmcn1 UTSW 1 150624561 missense probably damaging 1.00
RF005:Hmcn1 UTSW 1 150635146 nonsense probably null
X0022:Hmcn1 UTSW 1 150700530 missense probably benign 0.04
X0027:Hmcn1 UTSW 1 150860376 missense probably damaging 1.00
X0028:Hmcn1 UTSW 1 150663901 missense probably damaging 1.00
Z1088:Hmcn1 UTSW 1 150648937 missense probably damaging 1.00
Z1176:Hmcn1 UTSW 1 150586445 missense probably null 0.92
Z1176:Hmcn1 UTSW 1 150655921 missense possibly damaging 0.65
Z1176:Hmcn1 UTSW 1 150663917 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGAGCTCCTGTTCTCAGCTG -3'
(R):5'- TGGTCACATCACCTACATCTGTAG -3'

Sequencing Primer
(F):5'- TCAGCTGGCTGATGAAACTAACTG -3'
(R):5'- CTACATCTGTAGGGCAAAGATGAGTG -3'
Posted On 2017-03-01