Incidental Mutation 'R0568:Hspbp1'
Institutional Source Beutler Lab
Gene Symbol Hspbp1
Ensembl Gene ENSMUSG00000063802
Gene NameHSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R0568 (G1)
Quality Score225
Status Validated
Chromosomal Location4660521-4685068 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 4684432 bp
Amino Acid Change Leucine to Stop codon at position 60 (L60*)
Ref Sequence ENSEMBL: ENSMUSP00000146248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079970] [ENSMUST00000205952] [ENSMUST00000206306] [ENSMUST00000206946]
Predicted Effect probably null
Transcript: ENSMUST00000079970
AA Change: L15*
SMART Domains Protein: ENSMUSP00000078886
Gene: ENSMUSG00000063802
AA Change: L15*

low complexity region 19 35 N/A INTRINSIC
Pfam:Fes1 43 138 2.5e-12 PFAM
SCOP:d1ee4a_ 150 302 2e-12 SMART
Blast:ARM 216 256 3e-11 BLAST
Blast:ARM 259 299 4e-13 BLAST
low complexity region 306 342 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205952
AA Change: L15*
Predicted Effect probably null
Transcript: ENSMUST00000206306
AA Change: L15*
Predicted Effect probably null
Transcript: ENSMUST00000206946
AA Change: L60*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation show male infertility with an arrest of male meiosis, increased male germ cell apoptosis and azoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in Hspbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Hspbp1 APN 7 4664751 missense probably damaging 0.97
IGL02072:Hspbp1 APN 7 4677721 missense probably damaging 1.00
IGL02548:Hspbp1 APN 7 4681841 splice site probably benign
IGL02573:Hspbp1 APN 7 4677853 missense probably damaging 1.00
IGL03177:Hspbp1 APN 7 4664701 critical splice donor site probably null
IGL03181:Hspbp1 APN 7 4684364 missense probably damaging 1.00
R0670:Hspbp1 UTSW 7 4677736 missense probably damaging 1.00
R3013:Hspbp1 UTSW 7 4663484 missense probably benign 0.18
R3729:Hspbp1 UTSW 7 4677809 missense probably damaging 1.00
R3934:Hspbp1 UTSW 7 4664595 missense probably benign 0.41
R6031:Hspbp1 UTSW 7 4663466 missense probably benign 0.28
R6031:Hspbp1 UTSW 7 4663466 missense probably benign 0.28
R6034:Hspbp1 UTSW 7 4677712 missense probably damaging 1.00
R6034:Hspbp1 UTSW 7 4677712 missense probably damaging 1.00
R6728:Hspbp1 UTSW 7 4660782 missense possibly damaging 0.93
R6797:Hspbp1 UTSW 7 4660782 missense possibly damaging 0.93
R6930:Hspbp1 UTSW 7 4684607 missense probably benign
R6992:Hspbp1 UTSW 7 4664715 missense probably benign 0.23
R7459:Hspbp1 UTSW 7 4684578 missense probably benign 0.00
R7525:Hspbp1 UTSW 7 4663436 missense probably damaging 1.00
R7608:Hspbp1 UTSW 7 4660822 missense possibly damaging 0.73
R7962:Hspbp1 UTSW 7 4681842 critical splice donor site probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2013-06-11