Incidental Mutation 'R0568:Zswim9'
ID 46262
Institutional Source Beutler Lab
Gene Symbol Zswim9
Ensembl Gene ENSMUSG00000070814
Gene Name zinc finger SWIM-type containing 9
Synonyms 6330408A02Rik
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock # R0568 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 13258967-13278721 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13261026 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 401 (D401E)
Ref Sequence ENSEMBL: ENSMUSP00000112652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108532] [ENSMUST00000119139] [ENSMUST00000119558]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000108532
AA Change: D401E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104172
Gene: ENSMUSG00000070814
AA Change: D401E

low complexity region 213 224 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119139
AA Change: D401E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112652
Gene: ENSMUSG00000070814
AA Change: D401E

low complexity region 213 224 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135898
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Other mutations in Zswim9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01926:Zswim9 APN 7 13260321 missense possibly damaging 0.53
IGL02063:Zswim9 APN 7 13260681 missense probably damaging 0.98
R0680:Zswim9 UTSW 7 13260321 missense probably benign 0.10
R1438:Zswim9 UTSW 7 13277218 missense possibly damaging 0.86
R1600:Zswim9 UTSW 7 13269571 missense probably damaging 1.00
R1678:Zswim9 UTSW 7 13277411 missense probably benign 0.04
R1745:Zswim9 UTSW 7 13269556 missense probably damaging 1.00
R1938:Zswim9 UTSW 7 13260214 nonsense probably null
R2025:Zswim9 UTSW 7 13269366 missense probably damaging 0.98
R3149:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3150:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3176:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3177:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3276:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3277:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3950:Zswim9 UTSW 7 13261577 missense possibly damaging 0.95
R4554:Zswim9 UTSW 7 13277162 missense probably benign 0.33
R4866:Zswim9 UTSW 7 13261169 missense probably damaging 0.99
R4953:Zswim9 UTSW 7 13269558 missense probably damaging 1.00
R5330:Zswim9 UTSW 7 13259985 missense probably damaging 1.00
R5394:Zswim9 UTSW 7 13260983 missense probably damaging 1.00
R5408:Zswim9 UTSW 7 13260826 missense possibly damaging 0.66
R5654:Zswim9 UTSW 7 13261168 missense probably damaging 0.99
R5810:Zswim9 UTSW 7 13260735 missense probably damaging 0.98
R5859:Zswim9 UTSW 7 13261445 missense probably damaging 0.99
R6235:Zswim9 UTSW 7 13261603 missense probably damaging 1.00
R6239:Zswim9 UTSW 7 13261331 nonsense probably null
R6249:Zswim9 UTSW 7 13260977 missense probably damaging 0.98
R6394:Zswim9 UTSW 7 13260963 missense probably damaging 0.99
R7077:Zswim9 UTSW 7 13259752 missense probably damaging 1.00
R7133:Zswim9 UTSW 7 13259737 missense probably damaging 0.98
R7178:Zswim9 UTSW 7 13259997 missense possibly damaging 0.53
R7595:Zswim9 UTSW 7 13261072 missense probably benign 0.21
R8005:Zswim9 UTSW 7 13261138 missense probably damaging 0.98
R8138:Zswim9 UTSW 7 13261411 missense probably damaging 1.00
R8818:Zswim9 UTSW 7 13260529 missense probably benign 0.19
R9241:Zswim9 UTSW 7 13269434 missense probably damaging 1.00
R9277:Zswim9 UTSW 7 13261057 missense probably damaging 0.96
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2013-06-11