Mutagenetix > Incidental Mutations

Incidental Mutation 'R0568:Zswim9'

46262

Institutional Source

Beutler Lab

Gene Symbol

Zswim9

Ensembl Gene

ENSMUSG00000070814

Gene Name

zinc finger SWIM-type containing 9

Synonyms

6330408A02Rik

MMRRC Submission

038759-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R0568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13258967-13278721 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 13261026 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 401 (D401E)

Ref Sequence

ENSEMBL: ENSMUSP00000112652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108532] [ENSMUST00000119139] [ENSMUST00000119558]

Predicted Effect

probably damaging
Transcript: ENSMUST00000108532
AA Change: D401E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000104172
Gene: ENSMUSG00000070814
AA Change: D401E

Domain	Start	End	E-Value	Type
low complexity region	213	224	N/A	INTRINSIC
low complexity region	405	423	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119139
AA Change: D401E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112652
Gene: ENSMUSG00000070814
AA Change: D401E

Domain	Start	End	E-Value	Type
low complexity region	213	224	N/A	INTRINSIC
low complexity region	405	423	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119558

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135898

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,983,038	T181I	possibly damaging	Het
1810043G02Rik	A	T	10: 77,984,547	*250C	probably null	Het
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamts20	T	C	15: 94,291,713		probably benign	Het
Adamtsl1	T	C	4: 86,418,552	L1558S	probably damaging	Het
Ap3b2	A	G	7: 81,464,629		probably null	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
Brms1l	A	G	12: 55,861,388		probably null	Het
C8b	A	G	4: 104,793,380	I462V	probably benign	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Copa	T	C	1: 172,112,137	V624A	possibly damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Gtf2ird2	G	T	5: 134,211,242	E302*	probably null	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Ncapg2	T	A	12: 116,423,215	I286N	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Pitpnm2	A	G	5: 124,140,517		probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Polr3d	A	T	14: 70,439,519	H378Q	possibly damaging	Het
Ptpn13	T	C	5: 103,489,765	V173A	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Tprn	T	C	2: 25,264,321	V545A	probably damaging	Het
Trim66	T	C	7: 109,460,695	H828R	probably benign	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Vps9d1	A	G	8: 123,246,748	V432A	probably damaging	Het

Other mutations in Zswim9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01926:Zswim9	APN	7	13260321	missense	possibly damaging	0.53
IGL02063:Zswim9	APN	7	13260681	missense	probably damaging	0.98
R0680:Zswim9	UTSW	7	13260321	missense	probably benign	0.10
R1438:Zswim9	UTSW	7	13277218	missense	possibly damaging	0.86
R1600:Zswim9	UTSW	7	13269571	missense	probably damaging	1.00
R1678:Zswim9	UTSW	7	13277411	missense	probably benign	0.04
R1745:Zswim9	UTSW	7	13269556	missense	probably damaging	1.00
R1938:Zswim9	UTSW	7	13260214	nonsense	probably null
R2025:Zswim9	UTSW	7	13269366	missense	probably damaging	0.98
R3149:Zswim9	UTSW	7	13277270	missense	possibly damaging	0.94
R3150:Zswim9	UTSW	7	13277270	missense	possibly damaging	0.94
R3176:Zswim9	UTSW	7	13277270	missense	possibly damaging	0.94
R3177:Zswim9	UTSW	7	13277270	missense	possibly damaging	0.94
R3276:Zswim9	UTSW	7	13277270	missense	possibly damaging	0.94
R3277:Zswim9	UTSW	7	13277270	missense	possibly damaging	0.94
R3950:Zswim9	UTSW	7	13261577	missense	possibly damaging	0.95
R4554:Zswim9	UTSW	7	13277162	missense	probably benign	0.33
R4866:Zswim9	UTSW	7	13261169	missense	probably damaging	0.99
R4953:Zswim9	UTSW	7	13269558	missense	probably damaging	1.00
R5330:Zswim9	UTSW	7	13259985	missense	probably damaging	1.00
R5394:Zswim9	UTSW	7	13260983	missense	probably damaging	1.00
R5408:Zswim9	UTSW	7	13260826	missense	possibly damaging	0.66
R5654:Zswim9	UTSW	7	13261168	missense	probably damaging	0.99
R5810:Zswim9	UTSW	7	13260735	missense	probably damaging	0.98
R5859:Zswim9	UTSW	7	13261445	missense	probably damaging	0.99
R6235:Zswim9	UTSW	7	13261603	missense	probably damaging	1.00
R6239:Zswim9	UTSW	7	13261331	nonsense	probably null
R6249:Zswim9	UTSW	7	13260977	missense	probably damaging	0.98
R6394:Zswim9	UTSW	7	13260963	missense	probably damaging	0.99
R7077:Zswim9	UTSW	7	13259752	missense	probably damaging	1.00
R7133:Zswim9	UTSW	7	13259737	missense	probably damaging	0.98
R7178:Zswim9	UTSW	7	13259997	missense	possibly damaging	0.53
R7595:Zswim9	UTSW	7	13261072	missense	probably benign	0.21

Predicted Primers

PCR Primer
(F):5'- CTCCTTGACCATCTCTCAAGTGCAG -3'
(R):5'- TGCCGCCTAGCAGATTCAAAATCC -3'

Sequencing Primer
(F):5'- TCTCAAGTGCAGTCGCC -3'
(R):5'- ATCCTATACTGCTTACAGCGAGG -3'

Posted On

2013-06-11