Mutagenetix > Incidental Mutations

Incidental Mutation 'R5757:Otog'

462629

Institutional Source

Beutler Lab

Gene Symbol

Otog

Ensembl Gene

ENSMUSG00000009487

Gene Name

otogelin

Synonyms

Otgn

MMRRC Submission

043360-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.742) question?

Stock #

R5757 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46240987-46311434 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 46241121 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000130949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009667] [ENSMUST00000078680] [ENSMUST00000143155] [ENSMUST00000154292] [ENSMUST00000164538] [ENSMUST00000164538] [ENSMUST00000177212] [ENSMUST00000222454]

Predicted Effect

probably benign
Transcript: ENSMUST00000009667

SMART Domains

Protein: ENSMUSP00000009667
Gene: ENSMUSG00000030838

Domain	Start	End	E-Value	Type
PDZ	96	168	3.06e-19	SMART
low complexity region	190	203	N/A	INTRINSIC
PDZ	220	292	5.62e-18	SMART
coiled coil region	301	376	N/A	INTRINSIC
coiled coil region	419	478	N/A	INTRINSIC
low complexity region	515	529	N/A	INTRINSIC
low complexity region	562	596	N/A	INTRINSIC
low complexity region	600	612	N/A	INTRINSIC
PDZ	762	841	1.13e-13	SMART
low complexity region	846	860	N/A	INTRINSIC
low complexity region	899	910	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000078680

SMART Domains

Protein: ENSMUSP00000077747
Gene: ENSMUSG00000030838

Domain	Start	End	E-Value	Type
PDZ	96	168	3.06e-19	SMART
low complexity region	190	203	N/A	INTRINSIC
PDZ	220	292	5.62e-18	SMART
coiled coil region	301	376	N/A	INTRINSIC
PDZ	458	537	1.13e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143155

SMART Domains

Protein: ENSMUSP00000119676
Gene: ENSMUSG00000030838

Domain	Start	End	E-Value	Type
PDZ	96	168	3.06e-19	SMART
low complexity region	190	203	N/A	INTRINSIC
PDZ	220	292	5.62e-18	SMART
coiled coil region	301	376	N/A	INTRINSIC
coiled coil region	419	478	N/A	INTRINSIC
low complexity region	515	529	N/A	INTRINSIC
low complexity region	562	596	N/A	INTRINSIC
low complexity region	600	612	N/A	INTRINSIC
PDZ	762	841	1.13e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000154292

SMART Domains

Protein: ENSMUSP00000114494
Gene: ENSMUSG00000030838

Domain	Start	End	E-Value	Type
PDZ	96	168	3.06e-19	SMART
low complexity region	190	203	N/A	INTRINSIC
PDZ	220	292	5.62e-18	SMART
coiled coil region	301	376	N/A	INTRINSIC
coiled coil region	419	478	N/A	INTRINSIC
low complexity region	515	529	N/A	INTRINSIC
low complexity region	562	596	N/A	INTRINSIC
low complexity region	600	612	N/A	INTRINSIC
PDZ	762	841	1.13e-13	SMART
low complexity region	846	860	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000164538

SMART Domains

Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
VWD	128	288	7.98e-45	SMART
C8	330	404	1.05e-13	SMART
VWC	463	505	1.24e0	SMART
VWD	490	655	4.94e-50	SMART
C8	693	758	1.23e-5	SMART
Pfam:TIL	767	831	3.4e-13	PFAM
VWC	935	983	1.83e0	SMART
VWD	962	1118	6.05e-45	SMART
C8	1153	1227	1.02e-34	SMART
Pfam:AbfB	1270	1384	7.5e-10	PFAM
low complexity region	1488	1513	N/A	INTRINSIC
low complexity region	1524	1536	N/A	INTRINSIC
low complexity region	1560	1578	N/A	INTRINSIC
low complexity region	1637	1644	N/A	INTRINSIC
low complexity region	1677	1696	N/A	INTRINSIC
low complexity region	1731	1748	N/A	INTRINSIC
VWD	2087	2251	2.37e-29	SMART
C8	2287	2356	4.93e-19	SMART
low complexity region	2443	2449	N/A	INTRINSIC
CT	2828	2911	3.46e-28	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000164538

SMART Domains

Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
VWD	128	288	7.98e-45	SMART
C8	330	404	1.05e-13	SMART
VWC	463	505	1.24e0	SMART
VWD	490	655	4.94e-50	SMART
C8	693	758	1.23e-5	SMART
Pfam:TIL	767	831	3.4e-13	PFAM
VWC	935	983	1.83e0	SMART
VWD	962	1118	6.05e-45	SMART
C8	1153	1227	1.02e-34	SMART
Pfam:AbfB	1270	1384	7.5e-10	PFAM
low complexity region	1488	1513	N/A	INTRINSIC
low complexity region	1524	1536	N/A	INTRINSIC
low complexity region	1560	1578	N/A	INTRINSIC
low complexity region	1637	1644	N/A	INTRINSIC
low complexity region	1677	1696	N/A	INTRINSIC
low complexity region	1731	1748	N/A	INTRINSIC
VWD	2087	2251	2.37e-29	SMART
C8	2287	2356	4.93e-19	SMART
low complexity region	2443	2449	N/A	INTRINSIC
CT	2828	2911	3.46e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000177212

SMART Domains

Protein: ENSMUSP00000135734
Gene: ENSMUSG00000030838

Domain	Start	End	E-Value	Type
PDZ	96	168	3.06e-19	SMART
low complexity region	190	203	N/A	INTRINSIC
PDZ	220	291	6.13e-10	SMART
low complexity region	313	325	N/A	INTRINSIC
low complexity region	339	357	N/A	INTRINSIC
PDZ	439	518	1.13e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210281

Predicted Effect

probably benign
Transcript: ENSMUST00000222454

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	C	T	11: 110,042,968	A1204T	probably benign	Het
Adcy5	G	T	16: 35,272,081	R604L	probably damaging	Het
Ago4	A	T	4: 126,526,084	N33K	probably damaging	Het
Arid5b	T	C	10: 68,102,079	Y406C	probably damaging	Het
Asgr1	A	C	11: 70,054,952	H18P	probably benign	Het
Asph	A	C	4: 9,637,722		probably null	Het
Brd4	G	A	17: 32,201,298		probably benign	Het
Ccdc150	T	A	1: 54,263,620	I133N	probably damaging	Het
Cdon	A	C	9: 35,452,772	H62P	probably damaging	Het
Clec4b1	T	A	6: 123,069,754	Y157*	probably null	Het
Clip1	G	A	5: 123,627,397	T810I	probably benign	Het
Crocc	A	T	4: 141,043,564	L184Q	probably damaging	Het
Fat2	C	T	11: 55,252,346	G4226R	probably damaging	Het
Fbxo30	T	A	10: 11,290,421	C296S	probably benign	Het
Fndc3a	T	C	14: 72,556,585	K883E	probably benign	Het
Glyr1	A	T	16: 5,018,992	M436K	probably benign	Het
Gm525	A	T	11: 89,075,046	Q38L	probably benign	Het
Gnas	T	A	2: 174,345,247	V941D	probably damaging	Het
Hectd4	G	C	5: 121,348,619	E3226Q	possibly damaging	Het
Ints13	G	A	6: 146,550,106	R714C	probably benign	Het
Kif12	A	T	4: 63,170,518	W182R	probably damaging	Het
Kif21a	A	G	15: 90,951,345	L1272P	probably damaging	Het
Klhl14	A	C	18: 21,554,734	Y544D	probably damaging	Het
Kntc1	T	C	5: 123,807,309		probably null	Het
Lama1	G	A	17: 67,738,787	R229Q	possibly damaging	Het
Ltbp1	T	A	17: 75,273,949		probably null	Het
Map4k5	A	T	12: 69,824,655	C498S	probably damaging	Het
Myh9	A	T	15: 77,771,162	V1198E	probably benign	Het
Ncoa6	T	C	2: 155,411,608	D950G	probably damaging	Het
Obsl1	G	T	1: 75,493,055	A1106D	probably damaging	Het
Olfr1034	T	A	2: 86,046,566	V28E	possibly damaging	Het
Olfr1065	T	C	2: 86,445,578	I135V	probably benign	Het
Oxtr	A	T	6: 112,477,261	I14N	probably damaging	Het
Pfkfb3	A	T	2: 11,480,330	S490R	probably damaging	Het
Polk	A	C	13: 96,484,252	M560R	probably benign	Het
Polq	C	T	16: 37,086,681	H2335Y	probably benign	Het
Prr14	T	A	7: 127,475,553	V419D	possibly damaging	Het
Rflnb	A	G	11: 76,022,166	V132A	probably damaging	Het
Rxfp1	T	G	3: 79,661,320	I283L	possibly damaging	Het
Ryr3	G	A	2: 112,841,975	R1384C	probably damaging	Het
Scnn1g	T	A	7: 121,738,215	C100S	probably damaging	Het
Sfrp2	G	C	3: 83,766,626	G29R	possibly damaging	Het
Spop	A	G	11: 95,490,382	H312R	probably damaging	Het
Tpx2	A	G	2: 152,885,231		probably null	Het
Wdr4	A	T	17: 31,499,089	V337E	probably damaging	Het
Zbtb11	A	G	16: 56,007,029	N953D	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Otog

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Otog	APN	7	46251282	missense	probably damaging	1.00
IGL00725:Otog	APN	7	46274092	missense	probably damaging	1.00
IGL00757:Otog	APN	7	46290128	missense	probably damaging	1.00
IGL00822:Otog	APN	7	46295880	missense	probably benign	0.24
IGL01354:Otog	APN	7	46289726	missense	probably damaging	1.00
IGL01567:Otog	APN	7	46276615	splice site	probably benign
IGL02034:Otog	APN	7	46295993	nonsense	probably null
IGL02090:Otog	APN	7	46300147	missense	probably damaging	1.00
IGL02132:Otog	APN	7	46305479	missense	probably damaging	0.99
IGL02148:Otog	APN	7	46300587	missense	probably damaging	1.00
IGL02173:Otog	APN	7	46276741	splice site	probably benign
IGL02199:Otog	APN	7	46277351	missense	possibly damaging	0.90
IGL02216:Otog	APN	7	46301468	missense	probably damaging	1.00
IGL02322:Otog	APN	7	46301457	missense	probably benign	0.01
IGL02330:Otog	APN	7	46288069	missense	possibly damaging	0.84
IGL02529:Otog	APN	7	46259957	missense	probably damaging	0.99
IGL02898:Otog	APN	7	46310138	missense	probably damaging	1.00
IGL02970:Otog	APN	7	46295867	missense	probably benign	0.11
IGL03085:Otog	APN	7	46305922	critical splice donor site	probably null
IGL03108:Otog	APN	7	46251338	missense	probably damaging	1.00
IGL03275:Otog	APN	7	46306230	missense	probably damaging	1.00
BB010:Otog	UTSW	7	46310147	missense	probably damaging	1.00
BB020:Otog	UTSW	7	46310147	missense	probably damaging	1.00
I1329:Otog	UTSW	7	46246503	missense	probably benign	0.02
IGL02984:Otog	UTSW	7	46305508	missense	probably damaging	0.98
PIT4472001:Otog	UTSW	7	46295849	missense	probably damaging	1.00
R0032:Otog	UTSW	7	46288213	nonsense	probably null
R0032:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0105:Otog	UTSW	7	46288366	missense	possibly damaging	0.79
R0164:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0164:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0165:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0166:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0167:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0240:Otog	UTSW	7	46264032	splice site	probably null
R0240:Otog	UTSW	7	46264032	splice site	probably null
R0242:Otog	UTSW	7	46267381	missense	probably damaging	0.98
R0242:Otog	UTSW	7	46267381	missense	probably damaging	0.98
R0282:Otog	UTSW	7	46277493	missense	possibly damaging	0.93
R0392:Otog	UTSW	7	46250075	missense	probably benign	0.00
R0436:Otog	UTSW	7	46265936	splice site	probably benign
R0441:Otog	UTSW	7	46305877	missense	probably damaging	1.00
R0499:Otog	UTSW	7	46273832	missense	probably damaging	1.00
R0530:Otog	UTSW	7	46298244	missense	probably damaging	0.98
R0541:Otog	UTSW	7	46269249	splice site	probably benign
R0600:Otog	UTSW	7	46251395	splice site	probably benign
R0626:Otog	UTSW	7	46271373	missense	possibly damaging	0.95
R0636:Otog	UTSW	7	46264228	critical splice donor site	probably null
R0764:Otog	UTSW	7	46300494	missense	probably benign	0.00
R0833:Otog	UTSW	7	46269362	missense	possibly damaging	0.94
R0836:Otog	UTSW	7	46269362	missense	possibly damaging	0.94
R0844:Otog	UTSW	7	46287828	missense	possibly damaging	0.53
R1029:Otog	UTSW	7	46274595	missense	probably damaging	1.00
R1116:Otog	UTSW	7	46300601	splice site	probably benign
R1134:Otog	UTSW	7	46298514	missense	probably damaging	1.00
R1183:Otog	UTSW	7	46289755	missense	probably benign	0.41
R1204:Otog	UTSW	7	46259911	missense	probably benign	0.16
R1301:Otog	UTSW	7	46289689	missense	probably damaging	1.00
R1344:Otog	UTSW	7	46274615	missense	probably damaging	1.00
R1384:Otog	UTSW	7	46273695	splice site	probably benign
R1418:Otog	UTSW	7	46274615	missense	probably damaging	1.00
R1432:Otog	UTSW	7	46300583	missense	probably damaging	1.00
R1479:Otog	UTSW	7	46295978	missense	possibly damaging	0.75
R1521:Otog	UTSW	7	46259264	missense	possibly damaging	0.71
R1589:Otog	UTSW	7	46283908	missense	probably benign	0.18
R1671:Otog	UTSW	7	46261786	missense	probably damaging	1.00
R1773:Otog	UTSW	7	46288159	missense	probably benign	0.28
R1806:Otog	UTSW	7	46290937	critical splice acceptor site	probably null
R1843:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R1873:Otog	UTSW	7	46269343	missense	probably damaging	1.00
R1923:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R1927:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R2008:Otog	UTSW	7	46264074	missense	probably benign	0.43
R2048:Otog	UTSW	7	46287639	missense	probably damaging	1.00
R2131:Otog	UTSW	7	46250100	missense	probably damaging	1.00
R2153:Otog	UTSW	7	46302904	missense	probably damaging	1.00
R2240:Otog	UTSW	7	46241029	start codon destroyed	probably null
R2278:Otog	UTSW	7	46300044	missense	probably damaging	1.00
R2407:Otog	UTSW	7	46241540	missense	probably benign	0.10
R2424:Otog	UTSW	7	46298169	nonsense	probably null
R2513:Otog	UTSW	7	46305590	critical splice donor site	probably null
R2863:Otog	UTSW	7	46269306	missense	probably damaging	1.00
R3148:Otog	UTSW	7	46290169	missense	probably damaging	1.00
R3732:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3732:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3733:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3734:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3855:Otog	UTSW	7	46273760	missense	possibly damaging	0.65
R3880:Otog	UTSW	7	46288021	missense	possibly damaging	0.93
R4081:Otog	UTSW	7	46288299	missense	possibly damaging	0.92
R4349:Otog	UTSW	7	46274189	missense	probably damaging	0.99
R4382:Otog	UTSW	7	46289698	missense	probably damaging	1.00
R4392:Otog	UTSW	7	46285124	missense	probably damaging	0.98
R4520:Otog	UTSW	7	46241053	unclassified	probably benign
R4569:Otog	UTSW	7	46310147	missense	probably damaging	1.00
R4580:Otog	UTSW	7	46287801	missense	possibly damaging	0.78
R4672:Otog	UTSW	7	46289786	missense	probably damaging	0.98
R4764:Otog	UTSW	7	46288519	missense	probably benign	0.29
R4910:Otog	UTSW	7	46264062	missense	probably damaging	1.00
R4910:Otog	UTSW	7	46298534	missense	probably damaging	1.00
R4913:Otog	UTSW	7	46264102	missense	probably benign	0.31
R4975:Otog	UTSW	7	46287991	missense	probably benign	0.00
R4996:Otog	UTSW	7	46298606	missense	possibly damaging	0.51
R4996:Otog	UTSW	7	46305510	nonsense	probably null
R5116:Otog	UTSW	7	46273767	missense	probably benign	0.34
R5138:Otog	UTSW	7	46250006	missense	possibly damaging	0.61
R5169:Otog	UTSW	7	46298148	missense	probably benign	0.06
R5239:Otog	UTSW	7	46287435	missense	probably benign	0.15
R5277:Otog	UTSW	7	46246621	missense	possibly damaging	0.89
R5287:Otog	UTSW	7	46269329	missense	probably damaging	0.98
R5299:Otog	UTSW	7	46288851	missense	probably benign	0.16
R5378:Otog	UTSW	7	46255004	missense	probably damaging	1.00
R5382:Otog	UTSW	7	46249004	missense	probably damaging	1.00
R5487:Otog	UTSW	7	46288768	missense	probably benign	0.27
R5507:Otog	UTSW	7	46261699	missense	probably damaging	1.00
R5517:Otog	UTSW	7	46274571	missense	probably damaging	1.00
R5643:Otog	UTSW	7	46287447	missense	probably damaging	1.00
R5910:Otog	UTSW	7	46298598	missense	possibly damaging	0.94
R6019:Otog	UTSW	7	46288950	missense	probably benign	0.00
R6150:Otog	UTSW	7	46264059	missense	possibly damaging	0.82
R6225:Otog	UTSW	7	46249034	missense	possibly damaging	0.67
R6271:Otog	UTSW	7	46252040	missense	probably damaging	1.00
R6317:Otog	UTSW	7	46301215	missense	probably damaging	1.00
R6454:Otog	UTSW	7	46305817	missense	probably damaging	1.00
R6640:Otog	UTSW	7	46261743	missense	possibly damaging	0.92
R6753:Otog	UTSW	7	46249071	missense	probably benign	0.06
R6788:Otog	UTSW	7	46298317	missense	probably damaging	1.00
R6859:Otog	UTSW	7	46273781	missense	probably damaging	0.96
R7033:Otog	UTSW	7	46267398	critical splice donor site	probably null
R7071:Otog	UTSW	7	46267323	missense	probably damaging	1.00
R7084:Otog	UTSW	7	46298566	nonsense	probably null
R7116:Otog	UTSW	7	46298265	missense	probably damaging	0.99
R7202:Otog	UTSW	7	46288050	missense	probably damaging	0.97
R7365:Otog	UTSW	7	46298308	missense	probably damaging	1.00
R7468:Otog	UTSW	7	46264119	missense	probably benign
R7475:Otog	UTSW	7	46267276	missense	probably damaging	0.99
R7502:Otog	UTSW	7	46298615	missense	probably damaging	1.00
R7558:Otog	UTSW	7	46303160	missense	probably damaging	0.99
R7577:Otog	UTSW	7	46287855	missense	possibly damaging	0.62
R7651:Otog	UTSW	7	46241761	missense	probably benign	0.00
R7689:Otog	UTSW	7	46252056	missense	probably damaging	1.00
R7806:Otog	UTSW	7	46285776	missense	probably benign
R7933:Otog	UTSW	7	46310147	missense	probably damaging	1.00
R8021:Otog	UTSW	7	46267342	missense	probably damaging	0.98
R8082:Otog	UTSW	7	46289719	missense	probably damaging	1.00
R8531:Otog	UTSW	7	46252049	missense	probably damaging	0.99
RF024:Otog	UTSW	7	46287669	missense	probably damaging	1.00
X0062:Otog	UTSW	7	46259921	missense	probably damaging	1.00
Z1177:Otog	UTSW	7	46262852	missense	possibly damaging	0.80
Z1177:Otog	UTSW	7	46274538	missense	probably damaging	1.00
Z1177:Otog	UTSW	7	46289740	missense	probably damaging	1.00
Z1177:Otog	UTSW	7	46309985	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTGTAGCCTGGTTCTCAAC -3'
(R):5'- TGGACCTTTGGACCTCAGTTG -3'

Sequencing Primer
(F):5'- CAAGATTGCCCAGGATTGCAGC -3'
(R):5'- GACCTTTGGACCTCAGTTGTCTCTAG -3'

Posted On

2017-03-01