Mutagenetix > Incidental Mutation

Incidental Mutation 'R0568:Ap3b2'

46263

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

beta3B, Naptb

MMRRC Submission

038759-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R0568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81460399-81493925 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 81464629 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000080739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090]

AlphaFold

Q9JME5

Predicted Effect

probably null
Transcript: ENSMUST00000082090

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147624

Meta Mutation Damage Score

0.9496

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,983,038	T181I	possibly damaging	Het
1810043G02Rik	A	T	10: 77,984,547	*250C	probably null	Het
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamts20	T	C	15: 94,291,713		probably benign	Het
Adamtsl1	T	C	4: 86,418,552	L1558S	probably damaging	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
Brms1l	A	G	12: 55,861,388		probably null	Het
C8b	A	G	4: 104,793,380	I462V	probably benign	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Copa	T	C	1: 172,112,137	V624A	possibly damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Gtf2ird2	G	T	5: 134,211,242	E302*	probably null	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Ncapg2	T	A	12: 116,423,215	I286N	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Pitpnm2	A	G	5: 124,140,517		probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Polr3d	A	T	14: 70,439,519	H378Q	possibly damaging	Het
Ptpn13	T	C	5: 103,489,765	V173A	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Tprn	T	C	2: 25,264,321	V545A	probably damaging	Het
Trim66	T	C	7: 109,460,695	H828R	probably benign	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Vps9d1	A	G	8: 123,246,748	V432A	probably damaging	Het
Zswim9	A	T	7: 13,261,026	D401E	probably damaging	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81471949	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81476939	splice site	probably benign
IGL01876:Ap3b2	APN	7	81473854	splice site	probably null
IGL02132:Ap3b2	APN	7	81460998	missense	unknown
IGL02227:Ap3b2	APN	7	81473404	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81465698	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81473080	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81463681	splice site	probably null
R1035:Ap3b2	UTSW	7	81463911	missense	unknown
R1121:Ap3b2	UTSW	7	81464195	missense	unknown
R1160:Ap3b2	UTSW	7	81466169	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81463690	nonsense	probably null
R1542:Ap3b2	UTSW	7	81478077	splice site	probably null
R1652:Ap3b2	UTSW	7	81473399	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81467599	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81464150	missense	unknown
R2065:Ap3b2	UTSW	7	81463774	missense	unknown
R2353:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81477195	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81478017	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81477136	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81477930	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81476769	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81476752	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81493592	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81473462	nonsense	probably null
R6901:Ap3b2	UTSW	7	81484912	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81477993	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81461009	missense	unknown
R7317:Ap3b2	UTSW	7	81461028	missense	unknown
R7501:Ap3b2	UTSW	7	81473446	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81466146	splice site	probably null
R7643:Ap3b2	UTSW	7	81477072	missense	probably benign	0.24
R7707:Ap3b2	UTSW	7	81476782	missense	possibly damaging	0.60
R8111:Ap3b2	UTSW	7	81463782	missense	unknown
R8273:Ap3b2	UTSW	7	81463242	missense	unknown
R8325:Ap3b2	UTSW	7	81484489	splice site	probably null
R8355:Ap3b2	UTSW	7	81473103	missense	probably damaging	1.00
R8697:Ap3b2	UTSW	7	81473035	missense	possibly damaging	0.91
R8716:Ap3b2	UTSW	7	81477153	missense	probably benign	0.03
R8923:Ap3b2	UTSW	7	81477183	missense	probably benign	0.08
R9002:Ap3b2	UTSW	7	81467444	missense	probably benign	0.02
R9163:Ap3b2	UTSW	7	81463798	missense	unknown
R9304:Ap3b2	UTSW	7	81463271	missense	unknown
R9321:Ap3b2	UTSW	7	81464504	critical splice acceptor site	probably null
R9413:Ap3b2	UTSW	7	81478009	missense	possibly damaging	0.45
R9459:Ap3b2	UTSW	7	81473903	missense	probably benign	0.16
R9746:Ap3b2	UTSW	7	81476344	missense	probably damaging	1.00
X0013:Ap3b2	UTSW	7	81463240	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81463764	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACTCACAATCCTCTAGGTCCAGCAG -3'
(R):5'- ATGAAATAAGGTCCAAGCCAGACCG -3'

Sequencing Primer
(F):5'- CAGGGAAATCTCCTTGGCTACAG -3'
(R):5'- GAACAGAGTgaggaggaagatgag -3'

Posted On

2013-06-11