Mutagenetix > Incidental Mutations

Incidental Mutation 'R0568:Trim66'

46264

Institutional Source

Beutler Lab

Gene Symbol

Trim66

Ensembl Gene

ENSMUSG00000031026

Gene Name

tripartite motif-containing 66

Synonyms

Tif1d, D7H11orf29

MMRRC Submission

038759-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.219) question?

Stock #

R0568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109449006-109508134 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 109460695 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 828 (H828R)

Ref Sequence

ENSEMBL: ENSMUSP00000102352 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]

Predicted Effect

probably benign
Transcript: ENSMUST00000033339
AA Change: H726R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026
AA Change: H726R

Domain	Start	End	E-Value	Type
PHD	4	69	7.77e0	SMART
BBC	108	234	1.61e-39	SMART
low complexity region	318	333	N/A	INTRINSIC
low complexity region	452	486	N/A	INTRINSIC
low complexity region	517	530	N/A	INTRINSIC
low complexity region	568	581	N/A	INTRINSIC
PHD	998	1041	4.09e-10	SMART
BROMO	1069	1175	8.22e-27	SMART
low complexity region	1185	1199	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106739
AA Change: H726R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026
AA Change: H726R

Domain	Start	End	E-Value	Type
PHD	4	69	7.77e0	SMART
BBC	108	234	1.61e-39	SMART
low complexity region	318	333	N/A	INTRINSIC
low complexity region	452	486	N/A	INTRINSIC
low complexity region	517	530	N/A	INTRINSIC
low complexity region	568	581	N/A	INTRINSIC
PHD	998	1041	4.09e-10	SMART
BROMO	1069	1175	8.22e-27	SMART
low complexity region	1185	1199	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106741
AA Change: H828R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026
AA Change: H828R

Domain	Start	End	E-Value	Type
RING	28	78	2.38e-2	SMART
BBOX	102	140	1.48e0	SMART
PHD	106	171	7.77e0	SMART
RING	107	170	4.38e0	SMART
BBOX	162	203	4.21e-3	SMART
BBC	210	336	1.61e-39	SMART
low complexity region	420	435	N/A	INTRINSIC
low complexity region	554	588	N/A	INTRINSIC
low complexity region	619	632	N/A	INTRINSIC
low complexity region	670	683	N/A	INTRINSIC
PHD	1100	1143	4.09e-10	SMART
BROMO	1171	1277	8.22e-27	SMART
low complexity region	1287	1301	N/A	INTRINSIC

Meta Mutation Damage Score

0.0632

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,983,038	T181I	possibly damaging	Het
1810043G02Rik	A	T	10: 77,984,547	*250C	probably null	Het
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamts20	T	C	15: 94,291,713		probably benign	Het
Adamtsl1	T	C	4: 86,418,552	L1558S	probably damaging	Het
Ap3b2	A	G	7: 81,464,629		probably null	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
Brms1l	A	G	12: 55,861,388		probably null	Het
C8b	A	G	4: 104,793,380	I462V	probably benign	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Copa	T	C	1: 172,112,137	V624A	possibly damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Gtf2ird2	G	T	5: 134,211,242	E302*	probably null	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Ncapg2	T	A	12: 116,423,215	I286N	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Pitpnm2	A	G	5: 124,140,517		probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Polr3d	A	T	14: 70,439,519	H378Q	possibly damaging	Het
Ptpn13	T	C	5: 103,489,765	V173A	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Tprn	T	C	2: 25,264,321	V545A	probably damaging	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Vps9d1	A	G	8: 123,246,748	V432A	probably damaging	Het
Zswim9	A	T	7: 13,261,026	D401E	probably damaging	Het

Other mutations in Trim66

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01539:Trim66	APN	7	109455066	missense	probably benign	0.02
IGL01758:Trim66	APN	7	109486045	critical splice donor site	probably null
IGL01982:Trim66	APN	7	109458763	missense	probably benign	0.00
IGL01983:Trim66	APN	7	109458251	nonsense	probably null
IGL02149:Trim66	APN	7	109460902	missense	possibly damaging	0.66
IGL02392:Trim66	APN	7	109460274	missense	probably benign	0.01
IGL02483:Trim66	APN	7	109477630	splice site	probably benign
IGL02832:Trim66	APN	7	109460497	missense	probably damaging	1.00
IGL02945:Trim66	APN	7	109460176	nonsense	probably null
IGL03085:Trim66	APN	7	109458745	missense	probably benign	0.17
PIT1430001:Trim66	UTSW	7	109475247	missense	probably damaging	0.99
R0326:Trim66	UTSW	7	109460172	missense	probably benign	0.00
R0358:Trim66	UTSW	7	109460176	nonsense	probably null
R0401:Trim66	UTSW	7	109475264	missense	probably damaging	0.98
R0470:Trim66	UTSW	7	109457542	splice site	probably benign
R0669:Trim66	UTSW	7	109454992	intron	probably benign
R0980:Trim66	UTSW	7	109455670	missense	probably damaging	1.00
R1015:Trim66	UTSW	7	109455233	missense	probably damaging	1.00
R1078:Trim66	UTSW	7	109472319	missense	probably damaging	1.00
R1099:Trim66	UTSW	7	109475454	missense	probably benign	0.34
R1181:Trim66	UTSW	7	109484577	critical splice donor site	probably null
R1497:Trim66	UTSW	7	109484619	missense	probably benign	0.00
R1583:Trim66	UTSW	7	109455080	missense	probably damaging	1.00
R1843:Trim66	UTSW	7	109475839	missense	probably damaging	0.99
R1998:Trim66	UTSW	7	109484577	critical splice donor site	probably null
R2016:Trim66	UTSW	7	109472232	critical splice donor site	probably null
R2143:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R2144:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R2145:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R3945:Trim66	UTSW	7	109472268	missense	possibly damaging	0.94
R4012:Trim66	UTSW	7	109458131	missense	probably damaging	0.98
R4464:Trim66	UTSW	7	109477690	missense	possibly damaging	0.51
R4473:Trim66	UTSW	7	109481995	missense	probably damaging	1.00
R4729:Trim66	UTSW	7	109456060	critical splice donor site	probably null
R4730:Trim66	UTSW	7	109483069	missense	probably damaging	1.00
R4775:Trim66	UTSW	7	109457589	nonsense	probably null
R4819:Trim66	UTSW	7	109457586	missense	probably damaging	1.00
R5269:Trim66	UTSW	7	109457590	missense	probably benign	0.00
R5557:Trim66	UTSW	7	109483737	missense	probably benign	0.06
R5832:Trim66	UTSW	7	109455202	missense	probably damaging	1.00
R6220:Trim66	UTSW	7	109483093	missense	probably damaging	0.97
R6243:Trim66	UTSW	7	109460274	missense	probably benign	0.01
R6374:Trim66	UTSW	7	109486062	missense	probably benign
R6450:Trim66	UTSW	7	109460738	missense	probably benign	0.09
R6543:Trim66	UTSW	7	109475879	missense	probably benign	0.01
R6788:Trim66	UTSW	7	109477754	missense	probably damaging	1.00
R6842:Trim66	UTSW	7	109460776	missense	probably benign	0.00
R7169:Trim66	UTSW	7	109455121	missense	probably benign	0.25
R7257:Trim66	UTSW	7	109460244	missense	probably damaging	1.00
R7328:Trim66	UTSW	7	109457751	missense	probably damaging	0.99
R7616:Trim66	UTSW	7	109483749	missense	probably damaging	0.99
R8423:Trim66	UTSW	7	109475392	missense	possibly damaging	0.77
RF013:Trim66	UTSW	7	109460753	missense	probably damaging	0.99
RF024:Trim66	UTSW	7	109460740	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- GGGAATAGCCAAATCCTTGGGACC -3'
(R):5'- AAACTGTGTCCAGCCTGATGAGTG -3'

Sequencing Primer
(F):5'- CTTGTCCTACTGAGTCTGAGAAACG -3'
(R):5'- CAGCCTGATGAGTGTTTCAAACC -3'

Posted On

2013-06-11