Incidental Mutation 'R0568:Trim66'
ID 46264
Institutional Source Beutler Lab
Gene Symbol Trim66
Ensembl Gene ENSMUSG00000031026
Gene Name tripartite motif-containing 66
Synonyms Tif1d, D7H11orf29
MMRRC Submission 038759-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.155) question?
Stock # R0568 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 109048213-109107341 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 109059902 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 828 (H828R)
Ref Sequence ENSEMBL: ENSMUSP00000102352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]
AlphaFold Q924W6
Predicted Effect probably benign
Transcript: ENSMUST00000033339
AA Change: H726R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026
AA Change: H726R

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106739
AA Change: H726R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026
AA Change: H726R

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106741
AA Change: H828R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026
AA Change: H828R

DomainStartEndE-ValueType
RING 28 78 2.38e-2 SMART
BBOX 102 140 1.48e0 SMART
PHD 106 171 7.77e0 SMART
RING 107 170 4.38e0 SMART
BBOX 162 203 4.21e-3 SMART
BBC 210 336 1.61e-39 SMART
low complexity region 420 435 N/A INTRINSIC
low complexity region 554 588 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
PHD 1100 1143 4.09e-10 SMART
BROMO 1171 1277 8.22e-27 SMART
low complexity region 1287 1301 N/A INTRINSIC
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 G A 4: 49,451,003 (GRCm39) T36I possibly damaging Het
Adamts20 T C 15: 94,189,594 (GRCm39) probably benign Het
Adamtsl1 T C 4: 86,336,789 (GRCm39) L1558S probably damaging Het
Ap3b2 A G 7: 81,114,377 (GRCm39) probably null Het
Bag2 T C 1: 33,786,059 (GRCm39) M88V probably benign Het
Brms1l A G 12: 55,908,173 (GRCm39) probably null Het
C8b A G 4: 104,650,577 (GRCm39) I462V probably benign Het
Cfap410 C T 10: 77,818,872 (GRCm39) T181I possibly damaging Het
Cfap410 A T 10: 77,820,381 (GRCm39) *250C probably null Het
Cnpy4 A G 5: 138,190,839 (GRCm39) E167G probably damaging Het
Copa T C 1: 171,939,704 (GRCm39) V624A possibly damaging Het
Gm4553 G T 7: 141,719,357 (GRCm39) P24T unknown Het
Gna12 A G 5: 140,746,638 (GRCm39) V269A possibly damaging Het
Gtf2ird2 G T 5: 134,240,083 (GRCm39) E302* probably null Het
Hmcn2 C A 2: 31,305,248 (GRCm39) S3140R probably benign Het
Hspa4 A G 11: 53,153,703 (GRCm39) probably benign Het
Hspbp1 A T 7: 4,687,431 (GRCm39) L60* probably null Het
Lats1 A T 10: 7,588,292 (GRCm39) I970F possibly damaging Het
Lipo3 T C 19: 33,559,442 (GRCm39) probably benign Het
Lrrc3 T A 10: 77,737,419 (GRCm39) R6W probably damaging Het
Lxn C T 3: 67,368,335 (GRCm39) A143T probably damaging Het
Mga T C 2: 119,765,903 (GRCm39) I1390T probably damaging Het
Ncapg2 T A 12: 116,386,835 (GRCm39) I286N probably damaging Het
Or4c107 T A 2: 88,789,387 (GRCm39) Y192* probably null Het
Pitpnm2 A G 5: 124,278,580 (GRCm39) probably benign Het
Plxna2 T C 1: 194,433,694 (GRCm39) V581A probably benign Het
Polr3d A T 14: 70,676,959 (GRCm39) H378Q possibly damaging Het
Ptpn13 T C 5: 103,637,631 (GRCm39) V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Smc4 T C 3: 68,929,794 (GRCm39) probably null Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Syngr3 C T 17: 24,905,555 (GRCm39) A140T probably benign Het
Tent2 A G 13: 93,291,500 (GRCm39) S381P probably benign Het
Tprn T C 2: 25,154,333 (GRCm39) V545A probably damaging Het
Ugt2b5 G A 5: 87,285,224 (GRCm39) probably benign Het
Vps9d1 A G 8: 123,973,487 (GRCm39) V432A probably damaging Het
Zswim9 A T 7: 12,994,952 (GRCm39) D401E probably damaging Het
Other mutations in Trim66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Trim66 APN 7 109,054,273 (GRCm39) missense probably benign 0.02
IGL01758:Trim66 APN 7 109,085,252 (GRCm39) critical splice donor site probably null
IGL01982:Trim66 APN 7 109,057,970 (GRCm39) missense probably benign 0.00
IGL01983:Trim66 APN 7 109,057,458 (GRCm39) nonsense probably null
IGL02149:Trim66 APN 7 109,060,109 (GRCm39) missense possibly damaging 0.66
IGL02392:Trim66 APN 7 109,059,481 (GRCm39) missense probably benign 0.01
IGL02483:Trim66 APN 7 109,076,837 (GRCm39) splice site probably benign
IGL02832:Trim66 APN 7 109,059,704 (GRCm39) missense probably damaging 1.00
IGL02945:Trim66 APN 7 109,059,383 (GRCm39) nonsense probably null
IGL03085:Trim66 APN 7 109,057,952 (GRCm39) missense probably benign 0.17
PIT1430001:Trim66 UTSW 7 109,074,454 (GRCm39) missense probably damaging 0.99
R0326:Trim66 UTSW 7 109,059,379 (GRCm39) missense probably benign 0.00
R0358:Trim66 UTSW 7 109,059,383 (GRCm39) nonsense probably null
R0401:Trim66 UTSW 7 109,074,471 (GRCm39) missense probably damaging 0.98
R0470:Trim66 UTSW 7 109,056,749 (GRCm39) splice site probably benign
R0669:Trim66 UTSW 7 109,054,199 (GRCm39) intron probably benign
R0980:Trim66 UTSW 7 109,054,877 (GRCm39) missense probably damaging 1.00
R1015:Trim66 UTSW 7 109,054,440 (GRCm39) missense probably damaging 1.00
R1078:Trim66 UTSW 7 109,071,526 (GRCm39) missense probably damaging 1.00
R1099:Trim66 UTSW 7 109,074,661 (GRCm39) missense probably benign 0.34
R1181:Trim66 UTSW 7 109,083,784 (GRCm39) critical splice donor site probably null
R1497:Trim66 UTSW 7 109,083,826 (GRCm39) missense probably benign 0.00
R1583:Trim66 UTSW 7 109,054,287 (GRCm39) missense probably damaging 1.00
R1843:Trim66 UTSW 7 109,075,046 (GRCm39) missense probably damaging 0.99
R1998:Trim66 UTSW 7 109,083,784 (GRCm39) critical splice donor site probably null
R2016:Trim66 UTSW 7 109,071,439 (GRCm39) critical splice donor site probably null
R2143:Trim66 UTSW 7 109,074,320 (GRCm39) missense probably damaging 0.98
R2144:Trim66 UTSW 7 109,074,320 (GRCm39) missense probably damaging 0.98
R2145:Trim66 UTSW 7 109,074,320 (GRCm39) missense probably damaging 0.98
R3945:Trim66 UTSW 7 109,071,475 (GRCm39) missense possibly damaging 0.94
R4012:Trim66 UTSW 7 109,057,338 (GRCm39) missense probably damaging 0.98
R4464:Trim66 UTSW 7 109,076,897 (GRCm39) missense possibly damaging 0.51
R4473:Trim66 UTSW 7 109,081,202 (GRCm39) missense probably damaging 1.00
R4729:Trim66 UTSW 7 109,055,267 (GRCm39) critical splice donor site probably null
R4730:Trim66 UTSW 7 109,082,276 (GRCm39) missense probably damaging 1.00
R4775:Trim66 UTSW 7 109,056,796 (GRCm39) nonsense probably null
R4819:Trim66 UTSW 7 109,056,793 (GRCm39) missense probably damaging 1.00
R5269:Trim66 UTSW 7 109,056,797 (GRCm39) missense probably benign 0.00
R5557:Trim66 UTSW 7 109,082,944 (GRCm39) missense probably benign 0.06
R5832:Trim66 UTSW 7 109,054,409 (GRCm39) missense probably damaging 1.00
R6220:Trim66 UTSW 7 109,082,300 (GRCm39) missense probably damaging 0.97
R6243:Trim66 UTSW 7 109,059,481 (GRCm39) missense probably benign 0.01
R6374:Trim66 UTSW 7 109,085,269 (GRCm39) missense probably benign
R6450:Trim66 UTSW 7 109,059,945 (GRCm39) missense probably benign 0.09
R6543:Trim66 UTSW 7 109,075,086 (GRCm39) missense probably benign 0.01
R6788:Trim66 UTSW 7 109,076,961 (GRCm39) missense probably damaging 1.00
R6842:Trim66 UTSW 7 109,059,983 (GRCm39) missense probably benign 0.00
R7169:Trim66 UTSW 7 109,054,328 (GRCm39) missense probably benign 0.25
R7257:Trim66 UTSW 7 109,059,451 (GRCm39) missense probably damaging 1.00
R7328:Trim66 UTSW 7 109,056,958 (GRCm39) missense probably damaging 0.99
R7616:Trim66 UTSW 7 109,082,956 (GRCm39) missense probably damaging 0.99
R8423:Trim66 UTSW 7 109,074,599 (GRCm39) missense possibly damaging 0.77
R8855:Trim66 UTSW 7 109,081,188 (GRCm39) missense probably damaging 1.00
R9130:Trim66 UTSW 7 109,076,896 (GRCm39) missense possibly damaging 0.90
R9137:Trim66 UTSW 7 109,074,330 (GRCm39) missense probably damaging 0.99
R9640:Trim66 UTSW 7 109,074,825 (GRCm39) missense probably damaging 1.00
RF013:Trim66 UTSW 7 109,059,960 (GRCm39) missense probably damaging 0.99
RF024:Trim66 UTSW 7 109,059,947 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GGGAATAGCCAAATCCTTGGGACC -3'
(R):5'- AAACTGTGTCCAGCCTGATGAGTG -3'

Sequencing Primer
(F):5'- CTTGTCCTACTGAGTCTGAGAAACG -3'
(R):5'- CAGCCTGATGAGTGTTTCAAACC -3'
Posted On 2013-06-11