Mutagenetix > Incidental Mutations

Incidental Mutation 'R0568:Vps9d1'

46266

Institutional Source

Beutler Lab

Gene Symbol

Vps9d1

Ensembl Gene

ENSMUSG00000001062

Gene Name

VPS9 domain containing 1

Synonyms

MMRRC Submission

038759-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0568 (G1)

Quality Score

116

Status

Validated

Chromosome

Chromosomal Location

123242356-123254348 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123246748 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 432 (V432A)

Ref Sequence

ENSEMBL: ENSMUSP00000113575 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117643] [ENSMUST00000118279] [ENSMUST00000122363] [ENSMUST00000127664] [ENSMUST00000155869]

AlphaFold

Q8C190

Predicted Effect

probably damaging
Transcript: ENSMUST00000117643
AA Change: V432A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113748
Gene: ENSMUSG00000001062
AA Change: V432A

Domain	Start	End	E-Value	Type
low complexity region	96	108	N/A	INTRINSIC
coiled coil region	187	220	N/A	INTRINSIC
low complexity region	266	279	N/A	INTRINSIC
low complexity region	442	453	N/A	INTRINSIC
Pfam:VPS9	528	645	8.5e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000118279
AA Change: V432A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000113634
Gene: ENSMUSG00000001062
AA Change: V432A

Domain	Start	End	E-Value	Type
low complexity region	96	108	N/A	INTRINSIC
coiled coil region	187	220	N/A	INTRINSIC
low complexity region	266	279	N/A	INTRINSIC
low complexity region	442	453	N/A	INTRINSIC
Pfam:VPS9	528	645	1.2e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000122363
AA Change: V432A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113575
Gene: ENSMUSG00000001062
AA Change: V432A

Domain	Start	End	E-Value	Type
low complexity region	96	108	N/A	INTRINSIC
coiled coil region	187	220	N/A	INTRINSIC
low complexity region	266	279	N/A	INTRINSIC
low complexity region	442	453	N/A	INTRINSIC
Pfam:VPS9	528	644	5.6e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124508

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127978

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129591

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130275

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130965

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137569

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146136

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149490

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181432

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211876

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155853

Predicted Effect

probably benign
Transcript: ENSMUST00000155869

SMART Domains

Protein: ENSMUSP00000122184
Gene: ENSMUSG00000001062

Domain	Start	End	E-Value	Type
low complexity region	96	108	N/A	INTRINSIC
coiled coil region	187	223	N/A	INTRINSIC

Meta Mutation Damage Score

0.4168

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,983,038	T181I	possibly damaging	Het
1810043G02Rik	A	T	10: 77,984,547	*250C	probably null	Het
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamts20	T	C	15: 94,291,713		probably benign	Het
Adamtsl1	T	C	4: 86,418,552	L1558S	probably damaging	Het
Ap3b2	A	G	7: 81,464,629		probably null	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
Brms1l	A	G	12: 55,861,388		probably null	Het
C8b	A	G	4: 104,793,380	I462V	probably benign	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Copa	T	C	1: 172,112,137	V624A	possibly damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Gtf2ird2	G	T	5: 134,211,242	E302*	probably null	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Ncapg2	T	A	12: 116,423,215	I286N	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Pitpnm2	A	G	5: 124,140,517		probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Polr3d	A	T	14: 70,439,519	H378Q	possibly damaging	Het
Ptpn13	T	C	5: 103,489,765	V173A	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Tprn	T	C	2: 25,264,321	V545A	probably damaging	Het
Trim66	T	C	7: 109,460,695	H828R	probably benign	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Zswim9	A	T	7: 13,261,026	D401E	probably damaging	Het

Other mutations in Vps9d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00549:Vps9d1	APN	8	123245198	missense	probably damaging	1.00
IGL01112:Vps9d1	APN	8	123246030	missense	probably damaging	1.00
IGL01729:Vps9d1	APN	8	123247000	missense	probably damaging	1.00
R1191:Vps9d1	UTSW	8	123247967	missense	possibly damaging	0.95
R1813:Vps9d1	UTSW	8	123247039	missense	probably damaging	0.99
R1896:Vps9d1	UTSW	8	123247039	missense	probably damaging	0.99
R2193:Vps9d1	UTSW	8	123252665	missense	probably damaging	1.00
R2256:Vps9d1	UTSW	8	123245121	missense	probably benign	0.18
R4305:Vps9d1	UTSW	8	123248237	intron	probably benign
R4458:Vps9d1	UTSW	8	123247748	missense	probably benign	0.30
R4707:Vps9d1	UTSW	8	123248612	critical splice donor site	probably benign
R5366:Vps9d1	UTSW	8	123245114	missense	possibly damaging	0.89
R5392:Vps9d1	UTSW	8	123254013	missense	probably damaging	0.99
R5423:Vps9d1	UTSW	8	123247965	critical splice donor site	probably null
R5645:Vps9d1	UTSW	8	123247748	missense	probably benign	0.30
R5647:Vps9d1	UTSW	8	123248859	missense	probably damaging	1.00
R5695:Vps9d1	UTSW	8	123246916	missense	probably benign
R5908:Vps9d1	UTSW	8	123246824	missense	probably benign	0.28
R6061:Vps9d1	UTSW	8	123245671	missense	probably damaging	0.99
R6250:Vps9d1	UTSW	8	123248208	critical splice acceptor site	probably null
R6416:Vps9d1	UTSW	8	123248639	missense	probably damaging	1.00
R6747:Vps9d1	UTSW	8	123254007	missense	probably damaging	1.00
R7049:Vps9d1	UTSW	8	123247143	nonsense	probably null
R7584:Vps9d1	UTSW	8	123250717	missense	probably damaging	1.00
R8321:Vps9d1	UTSW	8	123248805	missense	possibly damaging	0.47
R9178:Vps9d1	UTSW	8	123248835	missense	probably damaging	0.97
R9218:Vps9d1	UTSW	8	123250935	missense	probably benign	0.12
R9366:Vps9d1	UTSW	8	123247747	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGAGGCACTAAAGTAGGCTAGGG -3'
(R):5'- TGCGCTGTATCCGATTGTGAGC -3'

Sequencing Primer
(F):5'- TAGGCTAGGGCCTGCTCTC -3'
(R):5'- TGCTGGATGGACCTCCTC -3'

Posted On

2013-06-11