Incidental Mutation 'R0568:Vps9d1'
ID 46266
Institutional Source Beutler Lab
Gene Symbol Vps9d1
Ensembl Gene ENSMUSG00000001062
Gene Name VPS9 domain containing 1
Synonyms
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0568 (G1)
Quality Score 116
Status Validated
Chromosome 8
Chromosomal Location 123242356-123254348 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123246748 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 432 (V432A)
Ref Sequence ENSEMBL: ENSMUSP00000113575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117643] [ENSMUST00000118279] [ENSMUST00000122363] [ENSMUST00000127664] [ENSMUST00000155869]
AlphaFold Q8C190
Predicted Effect probably damaging
Transcript: ENSMUST00000117643
AA Change: V432A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113748
Gene: ENSMUSG00000001062
AA Change: V432A

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 8.5e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118279
AA Change: V432A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113634
Gene: ENSMUSG00000001062
AA Change: V432A

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 1.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122363
AA Change: V432A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113575
Gene: ENSMUSG00000001062
AA Change: V432A

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 644 5.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124508
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155853
Predicted Effect probably benign
Transcript: ENSMUST00000155869
SMART Domains Protein: ENSMUSP00000122184
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 223 N/A INTRINSIC
Meta Mutation Damage Score 0.4168 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in Vps9d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Vps9d1 APN 8 123245198 missense probably damaging 1.00
IGL01112:Vps9d1 APN 8 123246030 missense probably damaging 1.00
IGL01729:Vps9d1 APN 8 123247000 missense probably damaging 1.00
R1191:Vps9d1 UTSW 8 123247967 missense possibly damaging 0.95
R1813:Vps9d1 UTSW 8 123247039 missense probably damaging 0.99
R1896:Vps9d1 UTSW 8 123247039 missense probably damaging 0.99
R2193:Vps9d1 UTSW 8 123252665 missense probably damaging 1.00
R2256:Vps9d1 UTSW 8 123245121 missense probably benign 0.18
R4305:Vps9d1 UTSW 8 123248237 intron probably benign
R4458:Vps9d1 UTSW 8 123247748 missense probably benign 0.30
R4707:Vps9d1 UTSW 8 123248612 critical splice donor site probably benign
R5366:Vps9d1 UTSW 8 123245114 missense possibly damaging 0.89
R5392:Vps9d1 UTSW 8 123254013 missense probably damaging 0.99
R5423:Vps9d1 UTSW 8 123247965 critical splice donor site probably null
R5645:Vps9d1 UTSW 8 123247748 missense probably benign 0.30
R5647:Vps9d1 UTSW 8 123248859 missense probably damaging 1.00
R5695:Vps9d1 UTSW 8 123246916 missense probably benign
R5908:Vps9d1 UTSW 8 123246824 missense probably benign 0.28
R6061:Vps9d1 UTSW 8 123245671 missense probably damaging 0.99
R6250:Vps9d1 UTSW 8 123248208 critical splice acceptor site probably null
R6416:Vps9d1 UTSW 8 123248639 missense probably damaging 1.00
R6747:Vps9d1 UTSW 8 123254007 missense probably damaging 1.00
R7049:Vps9d1 UTSW 8 123247143 nonsense probably null
R7584:Vps9d1 UTSW 8 123250717 missense probably damaging 1.00
R8321:Vps9d1 UTSW 8 123248805 missense possibly damaging 0.47
R9178:Vps9d1 UTSW 8 123248835 missense probably damaging 0.97
R9218:Vps9d1 UTSW 8 123250935 missense probably benign 0.12
R9366:Vps9d1 UTSW 8 123247747 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGAGGCACTAAAGTAGGCTAGGG -3'
(R):5'- TGCGCTGTATCCGATTGTGAGC -3'

Sequencing Primer
(F):5'- TAGGCTAGGGCCTGCTCTC -3'
(R):5'- TGCTGGATGGACCTCCTC -3'
Posted On 2013-06-11