Incidental Mutation 'R5745:Intu'
ID462707
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Nameinturned planar cell polarity protein
SynonymsPdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik
MMRRC Submission 043198-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5745 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location40531286-40704774 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 40692972 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091186]
Predicted Effect probably null
Transcript: ENSMUST00000091186
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204176
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,073 R74W probably damaging Het
4933407L21Rik T G 1: 85,931,274 probably null Het
Adcy8 A T 15: 64,920,471 I212N possibly damaging Het
Cobll1 T C 2: 65,098,457 T879A probably damaging Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Cpa5 T A 6: 30,630,437 M330K probably damaging Het
Dgcr8 A T 16: 18,280,443 N361K probably benign Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dock8 T A 19: 25,130,397 N830K probably benign Het
Ephb1 C T 9: 102,195,434 D49N probably benign Het
Fam19a1 G A 6: 96,649,185 R128Q probably damaging Het
Fer1l6 A G 15: 58,571,389 I514V probably benign Het
Fpr1 A G 17: 17,877,082 I215T probably benign Het
Hectd4 G A 5: 121,353,502 V3668M possibly damaging Het
Ighv3-4 T A 12: 114,253,768 I68L probably benign Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Mycbp2 A C 14: 103,156,453 S2781A possibly damaging Het
Myom2 T A 8: 15,122,705 S1211T probably benign Het
Nrp1 A T 8: 128,468,448 I462F probably benign Het
Olfr787 T A 10: 129,463,438 I254N probably damaging Het
Olfr958 T C 9: 39,550,691 Y60C probably damaging Het
Pcsk1 A C 13: 75,131,960 S635R probably benign Het
Pms1 A T 1: 53,207,702 Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Sema3b C A 9: 107,601,429 A356S probably damaging Het
Shoc2 C A 19: 54,029,892 T485K probably benign Het
Slc7a7 G A 14: 54,377,835 S235L possibly damaging Het
Smcr8 A T 11: 60,784,151 T918S probably benign Het
Tle3 C A 9: 61,414,851 F719L probably damaging Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40664266 missense probably benign 0.12
IGL01386:Intu APN 3 40692587 missense probably damaging 1.00
IGL02645:Intu APN 3 40701272 missense probably benign 0.01
IGL02869:Intu APN 3 40687786 missense probably damaging 1.00
IGL03263:Intu APN 3 40672597 nonsense probably null
H8562:Intu UTSW 3 40692673 missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40697603 missense probably benign 0.07
R0010:Intu UTSW 3 40654272 intron probably benign
R0173:Intu UTSW 3 40675346 critical splice donor site probably null
R0426:Intu UTSW 3 40675305 missense probably damaging 0.97
R1566:Intu UTSW 3 40692578 missense probably damaging 0.99
R1619:Intu UTSW 3 40697631 nonsense probably null
R1658:Intu UTSW 3 40692781 missense probably benign 0.20
R1701:Intu UTSW 3 40664264 missense probably damaging 1.00
R1707:Intu UTSW 3 40540924 missense probably benign 0.03
R1707:Intu UTSW 3 40683501 missense possibly damaging 0.69
R1867:Intu UTSW 3 40664335 missense probably damaging 1.00
R1868:Intu UTSW 3 40664335 missense probably damaging 1.00
R2090:Intu UTSW 3 40683536 missense probably benign 0.00
R2310:Intu UTSW 3 40653813 missense probably benign
R2989:Intu UTSW 3 40692710 missense probably benign 0.11
R4168:Intu UTSW 3 40672623 missense probably benign 0.00
R4530:Intu UTSW 3 40683364 missense possibly damaging 0.95
R5093:Intu UTSW 3 40692917 missense probably benign 0.00
R5541:Intu UTSW 3 40692587 unclassified probably null
R5587:Intu UTSW 3 40675308 missense probably damaging 0.99
R5809:Intu UTSW 3 40679590 missense probably damaging 0.99
R5939:Intu UTSW 3 40692584 missense probably damaging 1.00
R5953:Intu UTSW 3 40679550 missense probably damaging 1.00
R6000:Intu UTSW 3 40654148 nonsense probably null
R6063:Intu UTSW 3 40654094 missense probably damaging 0.97
R6245:Intu UTSW 3 40675326 missense probably damaging 0.98
R6310:Intu UTSW 3 40701291 nonsense probably null
R6353:Intu UTSW 3 40653708 missense probably damaging 1.00
R6451:Intu UTSW 3 40701293 missense possibly damaging 0.94
R6660:Intu UTSW 3 40531951 missense probably benign 0.00
R6848:Intu UTSW 3 40694255 missense probably benign 0.00
R7440:Intu UTSW 3 40697551 missense probably benign 0.04
R7625:Intu UTSW 3 40697599 missense probably benign
R7633:Intu UTSW 3 40654253 missense probably damaging 1.00
R7798:Intu UTSW 3 40691929 missense probably damaging 1.00
R7877:Intu UTSW 3 40699792 missense probably benign 0.07
R7960:Intu UTSW 3 40699792 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ACTATTCCTTCAAGGCACGG -3'
(R):5'- TGTCAATGTATGTGGCTGAAGC -3'

Sequencing Primer
(F):5'- GAAGCCCAGTCCCTCCAG -3'
(R):5'- GAAAGCACCCATCATTTCA -3'
Posted On2017-03-01