Incidental Mutation 'R0568:Hspa4'
ID46271
Institutional Source Beutler Lab
Gene Symbol Hspa4
Ensembl Gene ENSMUSG00000020361
Gene Nameheat shock protein 4
Synonyms70kDa, Hsp70RY, Hsp110, APG-2
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R0568 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location53259814-53300457 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 53262876 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020630]
Predicted Effect probably benign
Transcript: ENSMUST00000020630
SMART Domains Protein: ENSMUSP00000020630
Gene: ENSMUSG00000020361

DomainStartEndE-ValueType
Pfam:HSP70 3 608 2.9e-211 PFAM
Pfam:HSP70 590 693 3.8e-10 PFAM
low complexity region 787 800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151854
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit age-dependent neurofibrillary tangles and tau deposits, impaired contextual conditioning, and impaired bar grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in Hspa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Hspa4 APN 11 53280717 splice site probably null
IGL00701:Hspa4 APN 11 53271033 missense possibly damaging 0.89
IGL00957:Hspa4 APN 11 53280687 missense probably benign 0.00
IGL02324:Hspa4 APN 11 53300058 critical splice donor site probably null
IGL02328:Hspa4 APN 11 53300058 critical splice donor site probably null
IGL02336:Hspa4 APN 11 53262373 missense probably benign 0.00
IGL02441:Hspa4 APN 11 53270982 missense probably benign 0.03
IGL03323:Hspa4 APN 11 53265133 missense probably benign 0.05
IGL03356:Hspa4 APN 11 53269800 missense probably damaging 1.00
R0027:Hspa4 UTSW 11 53283585 missense probably benign 0.00
R0398:Hspa4 UTSW 11 53272879 critical splice acceptor site probably null
R0655:Hspa4 UTSW 11 53269692 missense probably benign 0.02
R1876:Hspa4 UTSW 11 53284156 missense probably benign 0.16
R2225:Hspa4 UTSW 11 53286933 missense probably benign 0.28
R3813:Hspa4 UTSW 11 53270979 missense probably benign 0.21
R3937:Hspa4 UTSW 11 53270949 missense probably benign 0.13
R4360:Hspa4 UTSW 11 53265092 missense probably damaging 1.00
R4457:Hspa4 UTSW 11 53280568 missense probably damaging 1.00
R4492:Hspa4 UTSW 11 53280469 missense probably damaging 1.00
R4751:Hspa4 UTSW 11 53284199 missense probably benign 0.22
R5032:Hspa4 UTSW 11 53289123 missense possibly damaging 0.89
R5233:Hspa4 UTSW 11 53286975 missense possibly damaging 0.46
R5320:Hspa4 UTSW 11 53262983 missense probably damaging 1.00
R5650:Hspa4 UTSW 11 53265092 missense probably damaging 1.00
R6108:Hspa4 UTSW 11 53261712 missense probably damaging 0.97
R6211:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6232:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6234:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6235:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6243:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6245:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6468:Hspa4 UTSW 11 53265056 missense probably benign 0.03
R7194:Hspa4 UTSW 11 53265938 missense probably damaging 1.00
R7308:Hspa4 UTSW 11 53267103 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGGAAGATGAGCAACTCCCTACCC -3'
(R):5'- GCGCATACACATACCCAGAGAGTG -3'

Sequencing Primer
(F):5'- aaaaccaactgtaacttcagcc -3'
(R):5'- GAGAGTGACAAATTAACCCCATTAC -3'
Posted On2013-06-11