Incidental Mutation 'R5749:Acsl6'
ID 462715
Institutional Source Beutler Lab
Gene Symbol Acsl6
Ensembl Gene ENSMUSG00000020333
Gene Name acyl-CoA synthetase long-chain family member 6
Synonyms Lacsl, Facl6, A330035H04Rik
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 54303798-54364756 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 54324055 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000145] [ENSMUST00000064690] [ENSMUST00000072178] [ENSMUST00000093106] [ENSMUST00000094194] [ENSMUST00000101211] [ENSMUST00000101213] [ENSMUST00000108899] [ENSMUST00000108904] [ENSMUST00000108905] [ENSMUST00000138515] [ENSMUST00000149403] [ENSMUST00000156252]
AlphaFold Q91WC3
Predicted Effect probably null
Transcript: ENSMUST00000000145
SMART Domains Protein: ENSMUSP00000000145
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
Pfam:AMP-binding 68 273 7.7e-39 PFAM
Pfam:AMP-binding 262 488 2.7e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000064690
SMART Domains Protein: ENSMUSP00000069844
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 102 346 5.5e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000072178
SMART Domains Protein: ENSMUSP00000072040
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000093106
SMART Domains Protein: ENSMUSP00000090795
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000094194
SMART Domains Protein: ENSMUSP00000091746
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101211
SMART Domains Protein: ENSMUSP00000098771
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 1.9e-103 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101213
SMART Domains Protein: ENSMUSP00000098773
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 1.9e-103 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108899
SMART Domains Protein: ENSMUSP00000104527
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 409 2.3e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108904
SMART Domains Protein: ENSMUSP00000104532
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:AMP-binding 128 588 1.6e-103 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108905
SMART Domains Protein: ENSMUSP00000104533
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:AMP-binding 128 588 7.7e-113 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000138515
SMART Domains Protein: ENSMUSP00000117128
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 101 192 5.1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149403
SMART Domains Protein: ENSMUSP00000120540
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SCOP:d1lci__ 82 139 2e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000156252
SMART Domains Protein: ENSMUSP00000119714
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
Pfam:AMP-binding 67 363 4.9e-54 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of acyl-CoA from fatty acids, ATP, and CoA, using magnesium as a cofactor. The encoded protein plays a major role in fatty acid metabolism in the brain. Translocations with the ETV6 gene are causes of myelodysplastic syndrome with basophilia, acute myelogenous leukemia with eosinophilia, and acute eosinophilic leukemia. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Acsl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Acsl6 APN 11 54325646 missense probably damaging 1.00
IGL01374:Acsl6 APN 11 54338419 missense probably damaging 1.00
IGL01455:Acsl6 APN 11 54323305 missense possibly damaging 0.93
IGL01607:Acsl6 APN 11 54352997 missense possibly damaging 0.94
IGL01731:Acsl6 APN 11 54350559 missense probably benign 0.04
IGL01775:Acsl6 APN 11 54346000 splice site probably benign
IGL02487:Acsl6 APN 11 54336943 missense possibly damaging 0.76
IGL02716:Acsl6 APN 11 54327276 missense probably benign 0.02
IGL02893:Acsl6 APN 11 54345899 missense probably damaging 1.00
R0514:Acsl6 UTSW 11 54350580 missense probably damaging 1.00
R0739:Acsl6 UTSW 11 54337135 missense probably damaging 1.00
R1593:Acsl6 UTSW 11 54323308 missense probably damaging 1.00
R1611:Acsl6 UTSW 11 54325564 missense possibly damaging 0.93
R1626:Acsl6 UTSW 11 54352046 missense probably damaging 1.00
R1633:Acsl6 UTSW 11 54328398 splice site probably benign
R1697:Acsl6 UTSW 11 54329966 missense probably damaging 1.00
R1852:Acsl6 UTSW 11 54361076 missense probably damaging 1.00
R1923:Acsl6 UTSW 11 54325591 missense probably damaging 1.00
R2081:Acsl6 UTSW 11 54320259 missense possibly damaging 0.76
R2144:Acsl6 UTSW 11 54341778 missense probably damaging 1.00
R2167:Acsl6 UTSW 11 54327157 missense probably benign 0.03
R2205:Acsl6 UTSW 11 54324007 missense probably damaging 1.00
R2357:Acsl6 UTSW 11 54327280 missense probably damaging 0.99
R4288:Acsl6 UTSW 11 54337086 missense probably benign 0.19
R4450:Acsl6 UTSW 11 54328403 missense probably damaging 1.00
R4783:Acsl6 UTSW 11 54336993 missense probably damaging 1.00
R5115:Acsl6 UTSW 11 54340498 splice site probably null
R5233:Acsl6 UTSW 11 54325606 missense possibly damaging 0.69
R5416:Acsl6 UTSW 11 54337171 missense probably benign 0.00
R5482:Acsl6 UTSW 11 54327138 missense probably damaging 1.00
R5633:Acsl6 UTSW 11 54337189 missense probably benign
R6139:Acsl6 UTSW 11 54340542 missense probably damaging 1.00
R6270:Acsl6 UTSW 11 54352107 missense probably benign 0.45
R6337:Acsl6 UTSW 11 54340542 missense probably damaging 1.00
R6571:Acsl6 UTSW 11 54325564 missense possibly damaging 0.85
R6736:Acsl6 UTSW 11 54325166 missense probably damaging 1.00
R6918:Acsl6 UTSW 11 54341756 splice site probably null
R6919:Acsl6 UTSW 11 54341756 splice site probably null
R7846:Acsl6 UTSW 11 54361075 missense probably damaging 0.98
R7910:Acsl6 UTSW 11 54345971 nonsense probably null
R8330:Acsl6 UTSW 11 54345208 missense probably benign 0.22
R8532:Acsl6 UTSW 11 54327175 missense probably damaging 1.00
R8535:Acsl6 UTSW 11 54338502 missense probably damaging 1.00
R8884:Acsl6 UTSW 11 54345902 missense probably damaging 1.00
R9036:Acsl6 UTSW 11 54337014 critical splice donor site probably null
R9052:Acsl6 UTSW 11 54341789 missense possibly damaging 0.78
Z1177:Acsl6 UTSW 11 54320172 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTGCTAGAGGGATGTTTCC -3'
(R):5'- ACTGTCACTATGCAGATAAACCAG -3'

Sequencing Primer
(F):5'- ATGTTTCCCTGGAGCCAGC -3'
(R):5'- CCAGACACCGAATTCACATTATTC -3'
Posted On 2017-03-01