Incidental Mutation 'R5749:Gtpbp4'
ID 462716
Institutional Source Beutler Lab
Gene Symbol Gtpbp4
Ensembl Gene ENSMUSG00000021149
Gene Name GTP binding protein 4
Synonyms Nog1, 2610028C09Rik, Crfg
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 8966331-8996083 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 8995947 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021574] [ENSMUST00000222098]
AlphaFold Q99ME9
Predicted Effect probably benign
Transcript: ENSMUST00000021574
SMART Domains Protein: ENSMUSP00000021574
Gene: ENSMUSG00000021149

DomainStartEndE-ValueType
Pfam:FeoB_N 169 335 4.7e-13 PFAM
Pfam:MMR_HSR1 170 290 1.7e-18 PFAM
Pfam:NOG1 235 292 1.3e-29 PFAM
Pfam:NOGCT 395 446 1.4e-24 PFAM
low complexity region 448 459 N/A INTRINSIC
low complexity region 467 479 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
low complexity region 560 575 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000222098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223218
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GTP-binding proteins are GTPases and function as molecular switches that can flip between two states: active, when GTP is bound, and inactive, when GDP is bound. 'Active' in this context usually means that the molecule acts as a signal to trigger other events in the cell. When an extracellular ligand binds to a G-protein-linked receptor, the receptor changes its conformation and switches on the trimeric G proteins that associate with it by causing them to eject their GDP and replace it with GTP. The switch is turned off when the G protein hydrolyzes its own bound GTP, converting it back to GDP. But before that occurs, the active protein has an opportunity to diffuse away from the receptor and deliver its message for a prolonged period to its downstream target. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Gtpbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Gtpbp4 APN 13 8977272 missense probably benign
IGL01319:Gtpbp4 APN 13 8985260 missense probably benign 0.05
IGL02108:Gtpbp4 APN 13 8985213 missense probably benign 0.20
IGL02116:Gtpbp4 APN 13 8992736 missense probably damaging 1.00
IGL02406:Gtpbp4 APN 13 8991750 missense possibly damaging 0.81
Atretic UTSW 13 8990737 nonsense probably null
enervated UTSW 13 8989105 missense possibly damaging 0.93
PIT4576001:Gtpbp4 UTSW 13 8991727 missense probably damaging 0.99
R0183:Gtpbp4 UTSW 13 8974961 missense probably benign 0.05
R0571:Gtpbp4 UTSW 13 8990686 splice site probably benign
R1420:Gtpbp4 UTSW 13 8973262 missense probably benign 0.00
R1641:Gtpbp4 UTSW 13 8973249 missense probably benign 0.22
R1840:Gtpbp4 UTSW 13 8979464 missense probably benign 0.00
R1967:Gtpbp4 UTSW 13 8977304 missense probably benign 0.01
R2883:Gtpbp4 UTSW 13 8990723 missense possibly damaging 0.86
R3862:Gtpbp4 UTSW 13 8990798 missense probably damaging 0.99
R4524:Gtpbp4 UTSW 13 8974294 missense probably benign 0.02
R4963:Gtpbp4 UTSW 13 8985217 missense probably damaging 1.00
R5009:Gtpbp4 UTSW 13 8989066 missense probably benign 0.05
R5555:Gtpbp4 UTSW 13 8979427 critical splice donor site probably null
R5860:Gtpbp4 UTSW 13 8973160 missense probably benign 0.00
R6449:Gtpbp4 UTSW 13 8990737 nonsense probably null
R6616:Gtpbp4 UTSW 13 8989105 missense possibly damaging 0.93
R7261:Gtpbp4 UTSW 13 8987918 missense probably benign 0.12
R7829:Gtpbp4 UTSW 13 8985330 splice site probably null
R7999:Gtpbp4 UTSW 13 8987286 missense probably damaging 1.00
R8698:Gtpbp4 UTSW 13 8974213 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGAGAGTGGGACTGATCTCC -3'
(R):5'- TGTGGGACTAGAAGCCTGTC -3'

Sequencing Primer
(F):5'- ACTGATCTCCGAGGGTCG -3'
(R):5'- TCAGGAAATGATGTAACGCTTGAGTC -3'
Posted On 2017-03-01