Mutagenetix > Incidental Mutations

Incidental Mutation 'R5749:Gtpbp4'

462716

Institutional Source

Beutler Lab

Gene Symbol

Gtpbp4

Ensembl Gene

ENSMUSG00000021149

Gene Name

GTP binding protein 4

Synonyms

Nog1, 2610028C09Rik, Crfg

MMRRC Submission

043200-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R5749 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8966331-8996083 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 8995947 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000152412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021574] [ENSMUST00000222098]

AlphaFold

Q99ME9

Predicted Effect

probably benign
Transcript: ENSMUST00000021574

SMART Domains

Protein: ENSMUSP00000021574
Gene: ENSMUSG00000021149

Domain	Start	End	E-Value	Type
Pfam:FeoB_N	169	335	4.7e-13	PFAM
Pfam:MMR_HSR1	170	290	1.7e-18	PFAM
Pfam:NOG1	235	292	1.3e-29	PFAM
Pfam:NOGCT	395	446	1.4e-24	PFAM
low complexity region	448	459	N/A	INTRINSIC
low complexity region	467	479	N/A	INTRINSIC
low complexity region	489	503	N/A	INTRINSIC
low complexity region	544	558	N/A	INTRINSIC
low complexity region	560	575	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000222098

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223218

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GTP-binding proteins are GTPases and function as molecular switches that can flip between two states: active, when GTP is bound, and inactive, when GDP is bound. 'Active' in this context usually means that the molecule acts as a signal to trigger other events in the cell. When an extracellular ligand binds to a G-protein-linked receptor, the receptor changes its conformation and switches on the trimeric G proteins that associate with it by causing them to eject their GDP and replace it with GTP. The switch is turned off when the G protein hydrolyzes its own bound GTP, converting it back to GDP. But before that occurs, the active protein has an opportunity to diffuse away from the receptor and deliver its message for a prolonged period to its downstream target. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl6	G	A	11: 54,324,055		probably null	Het
Ankrd12	T	C	17: 65,986,096	S781G	probably benign	Het
Bicc1	A	G	10: 70,946,969	S523P	probably benign	Het
Ccdc163	T	A	4: 116,714,112	C44*	probably null	Het
Ccdc83	T	C	7: 90,223,948	T400A	probably damaging	Het
Cobl	A	G	11: 12,266,965	S426P	possibly damaging	Het
Cyhr1	A	C	15: 76,658,644		probably null	Het
Cyp2b19	T	C	7: 26,763,419	I242T	possibly damaging	Het
Efnb2	A	C	8: 8,639,347	C92G	probably damaging	Het
Fam90a1a	T	A	8: 21,963,041	S137R	possibly damaging	Het
Fbxo17	G	A	7: 28,737,472	R284H	probably damaging	Het
Fem1b	A	G	9: 62,797,006	L324P	probably damaging	Het
Fsd1	T	A	17: 55,995,849		probably null	Het
Ifi209	A	C	1: 173,637,327	I8L	probably damaging	Het
Itga8	T	C	2: 12,262,078	E182G	probably damaging	Het
Itsn1	T	A	16: 91,906,855	L87H	probably damaging	Het
Klk1b16	T	C	7: 44,140,786	I160T	probably benign	Het
Lbp	T	A	2: 158,319,753	V52D	probably damaging	Het
Med23	T	C	10: 24,888,449	V318A	possibly damaging	Het
Myo16	C	T	8: 10,413,245	S604L	probably benign	Het
Olfr1113	C	T	2: 87,212,943	T17I	probably benign	Het
Olfr1448	A	G	19: 12,920,225	V28A	probably benign	Het
Olfr1510	T	A	14: 52,410,504	M123L	probably damaging	Het
Olfr768	A	T	10: 129,093,097	N292K	probably damaging	Het
Pcdh8	T	C	14: 79,770,085	D346G	probably damaging	Het
Ppara	A	T	15: 85,789,028	D140V	probably benign	Het
Prlr	T	A	15: 10,328,718	D426E	probably benign	Het
Prss36	T	A	7: 127,933,642	I192F	probably damaging	Het
Psg25	T	C	7: 18,524,851	E300G	probably damaging	Het
Pxylp1	A	G	9: 96,856,371	F26L	possibly damaging	Het
Rapgef4	A	T	2: 72,242,757	T796S	probably damaging	Het
Stard9	A	G	2: 120,703,786	H3508R	probably damaging	Het
Tep1	T	A	14: 50,844,072	D1282V	possibly damaging	Het
Tgfbr3l	A	G	8: 4,249,310	E59G	probably damaging	Het
Tnik	T	C	3: 28,594,092	M431T	probably benign	Het
Tns3	A	T	11: 8,451,177	H1040Q	probably benign	Het
Usp10	G	A	8: 119,941,133	E58K	probably damaging	Het
Vmn2r23	A	G	6: 123,733,273	T512A	probably benign	Het
Vmn2r52	C	T	7: 10,159,032	D727N	probably damaging	Het
Vmn2r66	T	A	7: 85,006,771	K346*	probably null	Het
Vmn2r93	T	A	17: 18,298,284	F2I	probably benign	Het
Zfp697	T	C	3: 98,425,464	S69P	probably benign	Het

Other mutations in Gtpbp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Gtpbp4	APN	13	8977272	missense	probably benign
IGL01319:Gtpbp4	APN	13	8985260	missense	probably benign	0.05
IGL02108:Gtpbp4	APN	13	8985213	missense	probably benign	0.20
IGL02116:Gtpbp4	APN	13	8992736	missense	probably damaging	1.00
IGL02406:Gtpbp4	APN	13	8991750	missense	possibly damaging	0.81
Atretic	UTSW	13	8990737	nonsense	probably null
enervated	UTSW	13	8989105	missense	possibly damaging	0.93
PIT4576001:Gtpbp4	UTSW	13	8991727	missense	probably damaging	0.99
R0183:Gtpbp4	UTSW	13	8974961	missense	probably benign	0.05
R0571:Gtpbp4	UTSW	13	8990686	splice site	probably benign
R1420:Gtpbp4	UTSW	13	8973262	missense	probably benign	0.00
R1641:Gtpbp4	UTSW	13	8973249	missense	probably benign	0.22
R1840:Gtpbp4	UTSW	13	8979464	missense	probably benign	0.00
R1967:Gtpbp4	UTSW	13	8977304	missense	probably benign	0.01
R2883:Gtpbp4	UTSW	13	8990723	missense	possibly damaging	0.86
R3862:Gtpbp4	UTSW	13	8990798	missense	probably damaging	0.99
R4524:Gtpbp4	UTSW	13	8974294	missense	probably benign	0.02
R4963:Gtpbp4	UTSW	13	8985217	missense	probably damaging	1.00
R5009:Gtpbp4	UTSW	13	8989066	missense	probably benign	0.05
R5555:Gtpbp4	UTSW	13	8979427	critical splice donor site	probably null
R5860:Gtpbp4	UTSW	13	8973160	missense	probably benign	0.00
R6449:Gtpbp4	UTSW	13	8990737	nonsense	probably null
R6616:Gtpbp4	UTSW	13	8989105	missense	possibly damaging	0.93
R7261:Gtpbp4	UTSW	13	8987918	missense	probably benign	0.12
R7829:Gtpbp4	UTSW	13	8985330	splice site	probably null
R7999:Gtpbp4	UTSW	13	8987286	missense	probably damaging	1.00
R8698:Gtpbp4	UTSW	13	8974213	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCAGAGAGTGGGACTGATCTCC -3'
(R):5'- TGTGGGACTAGAAGCCTGTC -3'

Sequencing Primer
(F):5'- ACTGATCTCCGAGGGTCG -3'
(R):5'- TCAGGAAATGATGTAACGCTTGAGTC -3'

Posted On

2017-03-01