Incidental Mutation 'R5749:Fsd1'
ID 462717
Institutional Source Beutler Lab
Gene Symbol Fsd1
Ensembl Gene ENSMUSG00000011589
Gene Name fibronectin type 3 and SPRY domain-containing protein
Synonyms
MMRRC Submission 043200-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.394) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 55986511-55996881 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 55995849 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000011733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011733] [ENSMUST00000043785]
AlphaFold Q7TPM6
Predicted Effect probably null
Transcript: ENSMUST00000011733
SMART Domains Protein: ENSMUSP00000011733
Gene: ENSMUSG00000011589

DomainStartEndE-ValueType
BBC 4 130 7.61e-9 SMART
FN3 165 255 2.96e-4 SMART
Pfam:SPRY 355 473 6.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043785
SMART Domains Protein: ENSMUSP00000038130
Gene: ENSMUSG00000038781

DomainStartEndE-ValueType
PH 20 120 1.22e-3 SMART
SH2 150 239 2.58e-3 SMART
low complexity region 278 297 N/A INTRINSIC
low complexity region 302 312 N/A INTRINSIC
low complexity region 343 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome associated protein that is characterized by an N-terminal coiled-coil region downstream of B-box (BBC) domain, a central fibronectin type III domain, and a C-terminal repeats in splA and RyR (SPRY) domain. The encoded protein associates with a subset of microtubules and may be involved in the stability and organization of microtubules during cytokinesis. [provided by RefSeq, Apr 2009]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 (GRCm38) probably null Het
Ankrd12 T C 17: 65,986,096 (GRCm38) S781G probably benign Het
Bicc1 A G 10: 70,946,969 (GRCm38) S523P probably benign Het
Ccdc163 T A 4: 116,714,112 (GRCm38) C44* probably null Het
Ccdc83 T C 7: 90,223,948 (GRCm38) T400A probably damaging Het
Cobl A G 11: 12,266,965 (GRCm38) S426P possibly damaging Het
Cyp2b19 T C 7: 26,763,419 (GRCm38) I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 (GRCm38) C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 (GRCm38) S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 (GRCm38) R284H probably damaging Het
Fem1b A G 9: 62,797,006 (GRCm38) L324P probably damaging Het
Gtpbp4 A G 13: 8,995,947 (GRCm38) probably null Het
Ifi209 A C 1: 173,637,327 (GRCm38) I8L probably damaging Het
Itga8 T C 2: 12,262,078 (GRCm38) E182G probably damaging Het
Itsn1 T A 16: 91,906,855 (GRCm38) L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 (GRCm38) I160T probably benign Het
Lbp T A 2: 158,319,753 (GRCm38) V52D probably damaging Het
Med23 T C 10: 24,888,449 (GRCm38) V318A possibly damaging Het
Myo16 C T 8: 10,413,245 (GRCm38) S604L probably benign Het
Or10ag52 C T 2: 87,212,943 (GRCm38) T17I probably benign Het
Or10g1 T A 14: 52,410,504 (GRCm38) M123L probably damaging Het
Or5b12 A G 19: 12,920,225 (GRCm38) V28A probably benign Het
Or6c38 A T 10: 129,093,097 (GRCm38) N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 (GRCm38) D346G probably damaging Het
Ppara A T 15: 85,789,028 (GRCm38) D140V probably benign Het
Prlr T A 15: 10,328,718 (GRCm38) D426E probably benign Het
Prss36 T A 7: 127,933,642 (GRCm38) I192F probably damaging Het
Psg25 T C 7: 18,524,851 (GRCm38) E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 (GRCm38) F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 (GRCm38) T796S probably damaging Het
Stard9 A G 2: 120,703,786 (GRCm38) H3508R probably damaging Het
Tep1 T A 14: 50,844,072 (GRCm38) D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 (GRCm38) E59G probably damaging Het
Tnik T C 3: 28,594,092 (GRCm38) M431T probably benign Het
Tns3 A T 11: 8,451,177 (GRCm38) H1040Q probably benign Het
Usp10 G A 8: 119,941,133 (GRCm38) E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 (GRCm38) T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 (GRCm38) D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 (GRCm38) K346* probably null Het
Vmn2r93 T A 17: 18,298,284 (GRCm38) F2I probably benign Het
Zfp697 T C 3: 98,425,464 (GRCm38) S69P probably benign Het
Zftraf1 A C 15: 76,658,644 (GRCm38) probably null Het
Other mutations in Fsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Fsd1 APN 17 55,993,943 (GRCm38) critical splice donor site probably null
IGL01023:Fsd1 APN 17 55,988,245 (GRCm38) missense probably damaging 1.00
IGL01382:Fsd1 APN 17 55,996,733 (GRCm38) missense probably damaging 1.00
IGL01383:Fsd1 APN 17 55,996,733 (GRCm38) missense probably damaging 1.00
IGL01384:Fsd1 APN 17 55,996,733 (GRCm38) missense probably damaging 1.00
IGL01386:Fsd1 APN 17 55,996,733 (GRCm38) missense probably damaging 1.00
IGL01387:Fsd1 APN 17 55,996,733 (GRCm38) missense probably damaging 1.00
IGL01561:Fsd1 APN 17 55,995,363 (GRCm38) missense probably benign
IGL02065:Fsd1 APN 17 55,996,499 (GRCm38) missense probably damaging 1.00
IGL02172:Fsd1 APN 17 55,990,244 (GRCm38) splice site probably benign
IGL02515:Fsd1 APN 17 55,996,303 (GRCm38) missense probably null 1.00
IGL02674:Fsd1 APN 17 55,996,483 (GRCm38) missense probably benign 0.04
IGL03135:Fsd1 APN 17 55,990,416 (GRCm38) splice site probably null
IGL03380:Fsd1 APN 17 55,995,456 (GRCm38) missense probably benign 0.00
Emboldened UTSW 17 55,990,542 (GRCm38) critical splice donor site probably null
1mM(1):Fsd1 UTSW 17 55,988,199 (GRCm38) missense probably benign 0.26
R0201:Fsd1 UTSW 17 55,990,522 (GRCm38) missense probably benign 0.00
R0521:Fsd1 UTSW 17 55,991,245 (GRCm38) missense probably benign
R0718:Fsd1 UTSW 17 55,996,445 (GRCm38) splice site probably null
R1077:Fsd1 UTSW 17 55,990,542 (GRCm38) critical splice donor site probably null
R1519:Fsd1 UTSW 17 55,993,870 (GRCm38) missense probably benign 0.14
R1696:Fsd1 UTSW 17 55,988,257 (GRCm38) critical splice donor site probably null
R1867:Fsd1 UTSW 17 55,991,254 (GRCm38) missense probably benign 0.00
R2173:Fsd1 UTSW 17 55,991,223 (GRCm38) missense possibly damaging 0.64
R3889:Fsd1 UTSW 17 55,993,893 (GRCm38) missense probably benign 0.27
R3950:Fsd1 UTSW 17 55,995,517 (GRCm38) critical splice donor site probably null
R4787:Fsd1 UTSW 17 55,996,257 (GRCm38) missense possibly damaging 0.51
R4912:Fsd1 UTSW 17 55,991,241 (GRCm38) missense possibly damaging 0.71
R4936:Fsd1 UTSW 17 55,996,452 (GRCm38) missense possibly damaging 0.63
R5718:Fsd1 UTSW 17 55,990,542 (GRCm38) critical splice donor site probably benign
R7077:Fsd1 UTSW 17 55,993,876 (GRCm38) missense probably damaging 1.00
R7078:Fsd1 UTSW 17 55,993,876 (GRCm38) missense probably damaging 1.00
R7091:Fsd1 UTSW 17 55,993,876 (GRCm38) missense probably damaging 1.00
R7092:Fsd1 UTSW 17 55,993,876 (GRCm38) missense probably damaging 1.00
R7137:Fsd1 UTSW 17 55,993,876 (GRCm38) missense probably damaging 1.00
R7173:Fsd1 UTSW 17 55,996,696 (GRCm38) missense possibly damaging 0.47
R7174:Fsd1 UTSW 17 55,991,356 (GRCm38) missense probably benign 0.01
R7474:Fsd1 UTSW 17 55,988,149 (GRCm38) missense possibly damaging 0.93
R7727:Fsd1 UTSW 17 55,988,150 (GRCm38) missense probably benign 0.00
R8113:Fsd1 UTSW 17 55,995,881 (GRCm38) missense probably benign
R9477:Fsd1 UTSW 17 55,988,720 (GRCm38) missense possibly damaging 0.63
X0022:Fsd1 UTSW 17 55,995,464 (GRCm38) nonsense probably null
Z1088:Fsd1 UTSW 17 55,991,203 (GRCm38) missense probably damaging 0.98
Z1177:Fsd1 UTSW 17 55,996,083 (GRCm38) missense probably benign 0.17
Z1187:Fsd1 UTSW 17 55,993,920 (GRCm38) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAAGGAGATTTTGAGCAGGGTTTAG -3'
(R):5'- AATCAGTGTGTCCCCTGCAG -3'

Sequencing Primer
(F):5'- CAGGGTTTAGATGTTTGATGGTTGAC -3'
(R):5'- TGCAGCCCGGAGACAGG -3'
Posted On 2017-03-01