Mutagenetix > Incidental Mutations

Incidental Mutation 'R0568:Brms1l'

46272

Institutional Source

Beutler Lab

Gene Symbol

Brms1l

Ensembl Gene

ENSMUSG00000012076

Gene Name

breast cancer metastasis-suppressor 1-like

Synonyms

D12Ertd407e, BRMS1, 0710008O11Rik

MMRRC Submission

038759-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.898) question?

Stock #

R0568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55836324-55869736 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 55861388 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000082500 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059250] [ENSMUST00000219419]

Predicted Effect

probably null
Transcript: ENSMUST00000059250

SMART Domains

Protein: ENSMUSP00000082500
Gene: ENSMUSG00000012076

Domain	Start	End	E-Value	Type
low complexity region	24	55	N/A	INTRINSIC
Pfam:Sds3	61	217	1.5e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000219419

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219575

Meta Mutation Damage Score

0.9498

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shows sequence similarity to the human breast carcinoma metastasis suppressor (BRMS1) protein and the mammalian Sds3 (suppressor of defective silencing 3) proteins. This protein is a component of the mSin3a family of histone deacetylase complexes (HDAC). [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,983,038	T181I	possibly damaging	Het
1810043G02Rik	A	T	10: 77,984,547	*250C	probably null	Het
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamts20	T	C	15: 94,291,713		probably benign	Het
Adamtsl1	T	C	4: 86,418,552	L1558S	probably damaging	Het
Ap3b2	A	G	7: 81,464,629		probably null	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
C8b	A	G	4: 104,793,380	I462V	probably benign	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Copa	T	C	1: 172,112,137	V624A	possibly damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Gtf2ird2	G	T	5: 134,211,242	E302*	probably null	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Ncapg2	T	A	12: 116,423,215	I286N	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Pitpnm2	A	G	5: 124,140,517		probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Polr3d	A	T	14: 70,439,519	H378Q	possibly damaging	Het
Ptpn13	T	C	5: 103,489,765	V173A	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Tprn	T	C	2: 25,264,321	V545A	probably damaging	Het
Trim66	T	C	7: 109,460,695	H828R	probably benign	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Vps9d1	A	G	8: 123,246,748	V432A	probably damaging	Het
Zswim9	A	T	7: 13,261,026	D401E	probably damaging	Het

Other mutations in Brms1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Brms1l	APN	12	55845326	missense	probably benign	0.15
IGL00951:Brms1l	APN	12	55866049	missense	possibly damaging	0.54
IGL02199:Brms1l	APN	12	55861172	critical splice donor site	probably benign
IGL02669:Brms1l	APN	12	55841616	missense	probably damaging	1.00
IGL03158:Brms1l	APN	12	55836535	missense	possibly damaging	0.83
IGL03184:Brms1l	APN	12	55868277	makesense	probably null
R0445:Brms1l	UTSW	12	55861406	nonsense	probably null
R0942:Brms1l	UTSW	12	55865957	missense	probably benign	0.00
R0968:Brms1l	UTSW	12	55866013	missense	possibly damaging	0.73
R1240:Brms1l	UTSW	12	55844508	missense	probably damaging	1.00
R1580:Brms1l	UTSW	12	55868222	missense	probably damaging	1.00
R1694:Brms1l	UTSW	12	55841600	missense	probably damaging	1.00
R1926:Brms1l	UTSW	12	55863161	missense	possibly damaging	0.69
R4626:Brms1l	UTSW	12	55863173	missense	probably benign	0.01
R4669:Brms1l	UTSW	12	55841571	missense	possibly damaging	0.83
R4987:Brms1l	UTSW	12	55866015	missense	probably benign	0.15
R6010:Brms1l	UTSW	12	55868200	missense	possibly damaging	0.55
R6129:Brms1l	UTSW	12	55868185	missense	probably benign	0.03
R7429:Brms1l	UTSW	12	55845299	missense	probably damaging	1.00
R7430:Brms1l	UTSW	12	55845299	missense	probably damaging	1.00
R7510:Brms1l	UTSW	12	55845322	nonsense	probably null
R7543:Brms1l	UTSW	12	55868212	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGCACTCTGGGTTTCCACACTG -3'
(R):5'- GCCCATGTTAAGCAAAGCATATTTCCAA -3'

Sequencing Primer
(F):5'- ACTGTGGAAACCATTTCGGC -3'
(R):5'- agtgggagtgggtgtgtag -3'

Posted On

2013-06-11