Incidental Mutation 'R5751:Emc2'
ID 462723
Institutional Source Beutler Lab
Gene Symbol Emc2
Ensembl Gene ENSMUSG00000022337
Gene Name ER membrane protein complex subunit 2
Synonyms
MMRRC Submission 043201-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock # R5751 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 43477229-43527763 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 43497057 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022962]
AlphaFold Q9CRD2
Predicted Effect probably null
Transcript: ENSMUST00000022962
SMART Domains Protein: ENSMUSP00000022962
Gene: ENSMUSG00000022337

DomainStartEndE-ValueType
coiled coil region 13 36 N/A INTRINSIC
Pfam:TPR_2 88 120 6.8e-5 PFAM
Pfam:TPR_19 98 151 5.9e-8 PFAM
Pfam:TPR_19 131 198 3.7e-8 PFAM
Pfam:TPR_2 155 188 2.4e-6 PFAM
Pfam:TPR_8 155 188 1.4e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228864
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,230,832 T1704A possibly damaging Het
Adam6a T A 12: 113,544,827 D273E possibly damaging Het
Adgrv1 T A 13: 81,522,236 L1610F probably damaging Het
Ago2 C T 15: 73,128,323 probably null Het
Apob T A 12: 8,012,619 Y87* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp7b A G 8: 22,018,128 V599A probably damaging Het
Dnah1 T A 14: 31,310,906 I391F probably benign Het
Gbp9 G T 5: 105,081,258 Q508K probably benign Het
Gm853 A C 4: 130,220,441 V61G probably benign Het
Grpel1 C T 5: 36,469,467 T31M probably benign Het
Gtf3c4 C T 2: 28,827,499 A790T probably damaging Het
Hmcn1 A G 1: 150,573,554 C115R probably damaging Het
Ik G A 18: 36,753,513 R346H probably benign Het
Lhx3 A G 2: 26,201,161 S379P probably benign Het
Mocs1 A G 17: 49,449,738 probably null Het
Mycbp2 C A 14: 103,148,550 V3457F probably damaging Het
Olfr1239 A T 2: 89,417,687 I242N probably damaging Het
Olfr128 A T 17: 37,923,970 I135L probably benign Het
Olfr1440 G A 19: 12,394,416 R51K probably benign Het
Orc5 C T 5: 22,499,971 probably null Het
Phf20 T C 2: 156,267,341 S203P probably benign Het
Pkd1l1 T C 11: 8,867,204 S1815G possibly damaging Het
Pnpla7 T C 2: 24,981,778 V11A probably damaging Het
Ranbp2 T C 10: 58,464,264 probably null Het
Ranbp3l A G 15: 9,063,089 D326G probably damaging Het
Rsph4a C T 10: 33,905,793 A213V probably damaging Het
Sema3b A G 9: 107,599,714 S570P probably benign Het
Spata31d1b T A 13: 59,718,973 C1312S probably benign Het
Sphkap G T 1: 83,275,897 T1377K probably benign Het
Stk32a A T 18: 43,305,020 R195W possibly damaging Het
Tacr2 T C 10: 62,252,990 I58T probably damaging Het
Tmem200c A T 17: 68,840,552 K43N probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Uckl1 A G 2: 181,574,452 S167P possibly damaging Het
Vmn2r90 A G 17: 17,733,866 Y764C probably damaging Het
Zan C T 5: 137,410,161 probably null Het
Other mutations in Emc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Emc2 APN 15 43511749 missense probably damaging 1.00
IGL02815:Emc2 APN 15 43507930 splice site probably benign
IGL03211:Emc2 APN 15 43507672 nonsense probably null
IGL03238:Emc2 APN 15 43507853 splice site probably null
R0433:Emc2 UTSW 15 43497124 splice site probably null
R1965:Emc2 UTSW 15 43527467 missense probably damaging 1.00
R2373:Emc2 UTSW 15 43513758 missense probably damaging 1.00
R2507:Emc2 UTSW 15 43511698 critical splice acceptor site probably null
R4986:Emc2 UTSW 15 43511784 missense probably benign 0.29
R5212:Emc2 UTSW 15 43510844 missense probably damaging 1.00
R5368:Emc2 UTSW 15 43511811 critical splice donor site probably null
R8136:Emc2 UTSW 15 43511806 missense probably benign 0.07
R9242:Emc2 UTSW 15 43495243 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTAATGCCACAGTCTCAAAACTC -3'
(R):5'- TTACTAGGGAGCAGGAAATGTC -3'

Sequencing Primer
(F):5'- CCACTGTATGTACATGAAATTAGTGG -3'
(R):5'- CTAGGGAGCAGGAAATGTCTTTAAAG -3'
Posted On 2017-03-01