Incidental Mutation 'R5751:Mocs1'
ID462725
Institutional Source Beutler Lab
Gene Symbol Mocs1
Ensembl Gene ENSMUSG00000064120
Gene Namemolybdenum cofactor synthesis 1
Synonyms3110045D15Rik
MMRRC Submission 043201-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5751 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location49428362-49455435 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 49449738 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000024797] [ENSMUST00000024797] [ENSMUST00000024797] [ENSMUST00000173033] [ENSMUST00000173033] [ENSMUST00000173033] [ENSMUST00000173362] [ENSMUST00000173362] [ENSMUST00000173362] [ENSMUST00000174647] [ENSMUST00000174647] [ENSMUST00000174647]
Predicted Effect probably null
Transcript: ENSMUST00000024797
SMART Domains Protein: ENSMUSP00000024797
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Elp3 70 273 1.63e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000024797
SMART Domains Protein: ENSMUSP00000024797
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Elp3 70 273 1.63e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000024797
SMART Domains Protein: ENSMUSP00000024797
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Elp3 70 273 1.63e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000172871
SMART Domains Protein: ENSMUSP00000134449
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Pfam:Mob_synth_C 1 86 8.6e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173033
SMART Domains Protein: ENSMUSP00000133694
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Elp3 70 273 1.63e-8 SMART
Pfam:MoaC 493 628 6.1e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173033
SMART Domains Protein: ENSMUSP00000133694
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Elp3 70 273 1.63e-8 SMART
Pfam:MoaC 493 628 6.1e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173033
SMART Domains Protein: ENSMUSP00000133694
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Elp3 70 273 1.63e-8 SMART
Pfam:MoaC 493 628 6.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173362
SMART Domains Protein: ENSMUSP00000134265
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Pfam:Fer4_12 67 197 5.8e-11 PFAM
Pfam:Radical_SAM 74 199 2.5e-22 PFAM
Pfam:Fer4_14 75 180 2.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173362
SMART Domains Protein: ENSMUSP00000134265
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Pfam:Fer4_12 67 197 5.8e-11 PFAM
Pfam:Radical_SAM 74 199 2.5e-22 PFAM
Pfam:Fer4_14 75 180 2.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173362
SMART Domains Protein: ENSMUSP00000134265
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Pfam:Fer4_12 67 197 5.8e-11 PFAM
Pfam:Radical_SAM 74 199 2.5e-22 PFAM
Pfam:Fer4_14 75 180 2.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173430
Predicted Effect probably benign
Transcript: ENSMUST00000174647
Predicted Effect probably benign
Transcript: ENSMUST00000174647
Predicted Effect probably benign
Transcript: ENSMUST00000174647
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation lack the cofactor molybdopterin and enzyme activities dependent on the cofactor (including sulfate oxidase and xanthine oxidase), have curly whiskers, and die between postnatal days 1 and 11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,230,832 T1704A possibly damaging Het
Adam6a T A 12: 113,544,827 D273E possibly damaging Het
Adgrv1 T A 13: 81,522,236 L1610F probably damaging Het
Ago2 C T 15: 73,128,323 probably null Het
Apob T A 12: 8,012,619 Y87* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp7b A G 8: 22,018,128 V599A probably damaging Het
Dnah1 T A 14: 31,310,906 I391F probably benign Het
Emc2 A G 15: 43,497,057 probably null Het
Gbp9 G T 5: 105,081,258 Q508K probably benign Het
Gm853 A C 4: 130,220,441 V61G probably benign Het
Grpel1 C T 5: 36,469,467 T31M probably benign Het
Gtf3c4 C T 2: 28,827,499 A790T probably damaging Het
Hmcn1 A G 1: 150,573,554 C115R probably damaging Het
Ik G A 18: 36,753,513 R346H probably benign Het
Lhx3 A G 2: 26,201,161 S379P probably benign Het
Mycbp2 C A 14: 103,148,550 V3457F probably damaging Het
Olfr1239 A T 2: 89,417,687 I242N probably damaging Het
Olfr128 A T 17: 37,923,970 I135L probably benign Het
Olfr1440 G A 19: 12,394,416 R51K probably benign Het
Orc5 C T 5: 22,499,971 probably null Het
Phf20 T C 2: 156,267,341 S203P probably benign Het
Pkd1l1 T C 11: 8,867,204 S1815G possibly damaging Het
Pnpla7 T C 2: 24,981,778 V11A probably damaging Het
Ranbp2 T C 10: 58,464,264 probably null Het
Ranbp3l A G 15: 9,063,089 D326G probably damaging Het
Rsph4a C T 10: 33,905,793 A213V probably damaging Het
Sema3b A G 9: 107,599,714 S570P probably benign Het
Spata31d1b T A 13: 59,718,973 C1312S probably benign Het
Sphkap G T 1: 83,275,897 T1377K probably benign Het
Stk32a A T 18: 43,305,020 R195W possibly damaging Het
Tacr2 T C 10: 62,252,990 I58T probably damaging Het
Tmem200c A T 17: 68,840,552 K43N probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Uckl1 A G 2: 181,574,452 S167P possibly damaging Het
Vmn2r90 A G 17: 17,733,866 Y764C probably damaging Het
Zan C T 5: 137,410,161 probably null Het
Other mutations in Mocs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Mocs1 APN 17 49435264 critical splice donor site probably null
IGL00473:Mocs1 APN 17 49433201 missense probably benign 0.01
IGL01565:Mocs1 APN 17 49452320 missense probably benign 0.00
IGL02822:Mocs1 APN 17 49439569 missense probably damaging 1.00
R0321:Mocs1 UTSW 17 49433258 missense probably damaging 1.00
R1313:Mocs1 UTSW 17 49454269 missense probably benign 0.00
R1313:Mocs1 UTSW 17 49454269 missense probably benign 0.00
R2155:Mocs1 UTSW 17 49454358 missense probably damaging 1.00
R2271:Mocs1 UTSW 17 49449109 missense probably damaging 1.00
R2398:Mocs1 UTSW 17 49452834 missense probably damaging 0.99
R4669:Mocs1 UTSW 17 49454585 missense possibly damaging 0.67
R5566:Mocs1 UTSW 17 49454183 missense possibly damaging 0.92
R6061:Mocs1 UTSW 17 49450313 missense probably damaging 1.00
R6157:Mocs1 UTSW 17 49454736 missense probably benign 0.06
R6212:Mocs1 UTSW 17 49435196 missense probably damaging 1.00
R6268:Mocs1 UTSW 17 49435155 missense probably damaging 1.00
R7047:Mocs1 UTSW 17 49452859 critical splice donor site probably null
R7270:Mocs1 UTSW 17 49449115 missense possibly damaging 0.83
R7395:Mocs1 UTSW 17 49454557 missense possibly damaging 0.56
R7522:Mocs1 UTSW 17 49435264 critical splice donor site probably null
R7872:Mocs1 UTSW 17 49439533 missense probably damaging 1.00
R7955:Mocs1 UTSW 17 49439533 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGTGCGCTTCATTGAGTAC -3'
(R):5'- AACTCTGATGATGGCAGGACC -3'

Sequencing Primer
(F):5'- CATTGAGTACATGCCATTTGACGG -3'
(R):5'- GGACCATCCCCCAGGTCTAC -3'
Posted On2017-03-01