Incidental Mutation 'R0568:Ncapg2'
ID46273
Institutional Source Beutler Lab
Gene Symbol Ncapg2
Ensembl Gene ENSMUSG00000042029
Gene Namenon-SMC condensin II complex, subunit G2
SynonymsLuzp5, 5830426I05Rik, mCAP-G2, Mtb
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0568 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location116405402-116463731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116423215 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 286 (I286N)
Ref Sequence ENSEMBL: ENSMUSP00000081889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084828]
Predicted Effect probably damaging
Transcript: ENSMUST00000084828
AA Change: I286N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081889
Gene: ENSMUSG00000042029
AA Change: I286N

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Condensin2nSMC 212 361 7.2e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220608
Meta Mutation Damage Score 0.8105 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Condensin2nSMC family of proteins. The encoded protein is a regulatory subunit of the condensin II complex which, along with the condensin I complex, plays a role in chromosome assembly and segregation during mitosis. A similar protein in mouse is required for early development of the embryo. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null embryos exhibit impaired inner cell mass expansion and die shortly after implantation and prior to gastrulation and blood cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in Ncapg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ncapg2 APN 12 116424650 missense possibly damaging 0.54
IGL01694:Ncapg2 APN 12 116407230 utr 5 prime probably benign
IGL01724:Ncapg2 APN 12 116426711 missense probably damaging 1.00
IGL01792:Ncapg2 APN 12 116425818 missense probably damaging 0.99
IGL02098:Ncapg2 APN 12 116444332 missense possibly damaging 0.59
IGL02136:Ncapg2 APN 12 116460583 missense probably benign
IGL02409:Ncapg2 APN 12 116420717 missense probably damaging 1.00
IGL02580:Ncapg2 APN 12 116420689 missense probably damaging 1.00
IGL02653:Ncapg2 APN 12 116425906 critical splice donor site probably null
IGL03073:Ncapg2 APN 12 116452274 missense probably benign 0.01
IGL03114:Ncapg2 APN 12 116452373 splice site probably benign
IGL03199:Ncapg2 APN 12 116419236 missense probably damaging 1.00
IGL03328:Ncapg2 APN 12 116440057 missense possibly damaging 0.90
P0033:Ncapg2 UTSW 12 116438635 missense probably benign 0.03
R0008:Ncapg2 UTSW 12 116429835 missense probably damaging 1.00
R0194:Ncapg2 UTSW 12 116420683 splice site probably null
R0379:Ncapg2 UTSW 12 116443075 missense probably damaging 1.00
R0771:Ncapg2 UTSW 12 116413159 nonsense probably null
R1016:Ncapg2 UTSW 12 116438675 missense probably damaging 1.00
R1507:Ncapg2 UTSW 12 116460566 missense probably benign 0.00
R1524:Ncapg2 UTSW 12 116434578 splice site probably benign
R1596:Ncapg2 UTSW 12 116419236 missense probably damaging 1.00
R1635:Ncapg2 UTSW 12 116434685 frame shift probably null
R1752:Ncapg2 UTSW 12 116426718 missense probably damaging 1.00
R2164:Ncapg2 UTSW 12 116450475 splice site probably null
R2266:Ncapg2 UTSW 12 116429676 missense probably damaging 1.00
R2366:Ncapg2 UTSW 12 116420729 nonsense probably null
R2924:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R2925:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R3828:Ncapg2 UTSW 12 116407318 splice site probably benign
R3829:Ncapg2 UTSW 12 116407318 splice site probably benign
R4384:Ncapg2 UTSW 12 116439877 critical splice donor site probably null
R4651:Ncapg2 UTSW 12 116425787 missense probably damaging 1.00
R4701:Ncapg2 UTSW 12 116440618 missense probably benign
R4821:Ncapg2 UTSW 12 116415457 missense probably damaging 0.99
R4845:Ncapg2 UTSW 12 116440588 missense probably damaging 0.96
R5135:Ncapg2 UTSW 12 116427786 missense possibly damaging 0.64
R5294:Ncapg2 UTSW 12 116427794 missense possibly damaging 0.54
R5334:Ncapg2 UTSW 12 116426637 missense probably damaging 1.00
R5588:Ncapg2 UTSW 12 116413077 missense possibly damaging 0.95
R5888:Ncapg2 UTSW 12 116425800 missense possibly damaging 0.84
R5938:Ncapg2 UTSW 12 116429657 missense probably damaging 1.00
R5978:Ncapg2 UTSW 12 116424671 missense possibly damaging 0.68
R6016:Ncapg2 UTSW 12 116426607 missense probably damaging 1.00
R6026:Ncapg2 UTSW 12 116443021 missense possibly damaging 0.73
R6155:Ncapg2 UTSW 12 116438011 missense possibly damaging 0.83
R6509:Ncapg2 UTSW 12 116427756 missense probably damaging 1.00
R6675:Ncapg2 UTSW 12 116434661 missense possibly damaging 0.71
R6912:Ncapg2 UTSW 12 116426582 missense probably benign
R7069:Ncapg2 UTSW 12 116424717 splice site probably null
R7339:Ncapg2 UTSW 12 116414834 missense probably damaging 0.96
R7440:Ncapg2 UTSW 12 116450413 missense possibly damaging 0.89
R7445:Ncapg2 UTSW 12 116419268 missense possibly damaging 0.50
R7704:Ncapg2 UTSW 12 116419277 missense probably damaging 1.00
R8061:Ncapg2 UTSW 12 116426577 missense probably benign
R8132:Ncapg2 UTSW 12 116444347 missense possibly damaging 0.93
R8166:Ncapg2 UTSW 12 116412416 missense probably benign 0.00
X0020:Ncapg2 UTSW 12 116424707 missense probably damaging 1.00
Z1177:Ncapg2 UTSW 12 116438605 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACAGCTCTGACAGAATAGCGGACG -3'
(R):5'- AGAGCCAGTAGCAGAACAAATTGCC -3'

Sequencing Primer
(F):5'- CTGACAGAATAGCGGACGTTTTC -3'
(R):5'- CTAAGAAATTCCTTTGACTGATGGGG -3'
Posted On2013-06-11