Mutagenetix > Incidental Mutations

Incidental Mutation 'R0568:Ncapg2'

46273

Institutional Source

Beutler Lab

Gene Symbol

Ncapg2

Ensembl Gene

ENSMUSG00000042029

Gene Name

non-SMC condensin II complex, subunit G2

Synonyms

Luzp5, 5830426I05Rik, mCAP-G2, Mtb

MMRRC Submission

038759-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116405402-116463731 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 116423215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 286 (I286N)

Ref Sequence

ENSEMBL: ENSMUSP00000081889 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084828]

AlphaFold

Q6DFV1

Predicted Effect

probably damaging
Transcript: ENSMUST00000084828
AA Change: I286N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000081889
Gene: ENSMUSG00000042029
AA Change: I286N

Domain	Start	End	E-Value	Type
low complexity region	14	25	N/A	INTRINSIC
Pfam:Condensin2nSMC	212	361	7.2e-62	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220608

Meta Mutation Damage Score

0.8105

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Condensin2nSMC family of proteins. The encoded protein is a regulatory subunit of the condensin II complex which, along with the condensin I complex, plays a role in chromosome assembly and segregation during mitosis. A similar protein in mouse is required for early development of the embryo. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null embryos exhibit impaired inner cell mass expansion and die shortly after implantation and prior to gastrulation and blood cell development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,983,038	T181I	possibly damaging	Het
1810043G02Rik	A	T	10: 77,984,547	*250C	probably null	Het
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamts20	T	C	15: 94,291,713		probably benign	Het
Adamtsl1	T	C	4: 86,418,552	L1558S	probably damaging	Het
Ap3b2	A	G	7: 81,464,629		probably null	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
Brms1l	A	G	12: 55,861,388		probably null	Het
C8b	A	G	4: 104,793,380	I462V	probably benign	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Copa	T	C	1: 172,112,137	V624A	possibly damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Gtf2ird2	G	T	5: 134,211,242	E302*	probably null	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Pitpnm2	A	G	5: 124,140,517		probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Polr3d	A	T	14: 70,439,519	H378Q	possibly damaging	Het
Ptpn13	T	C	5: 103,489,765	V173A	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Tprn	T	C	2: 25,264,321	V545A	probably damaging	Het
Trim66	T	C	7: 109,460,695	H828R	probably benign	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Vps9d1	A	G	8: 123,246,748	V432A	probably damaging	Het
Zswim9	A	T	7: 13,261,026	D401E	probably damaging	Het

Other mutations in Ncapg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01410:Ncapg2	APN	12	116424650	missense	possibly damaging	0.54
IGL01694:Ncapg2	APN	12	116407230	utr 5 prime	probably benign
IGL01724:Ncapg2	APN	12	116426711	missense	probably damaging	1.00
IGL01792:Ncapg2	APN	12	116425818	missense	probably damaging	0.99
IGL02098:Ncapg2	APN	12	116444332	missense	possibly damaging	0.59
IGL02136:Ncapg2	APN	12	116460583	missense	probably benign
IGL02409:Ncapg2	APN	12	116420717	missense	probably damaging	1.00
IGL02580:Ncapg2	APN	12	116420689	missense	probably damaging	1.00
IGL02653:Ncapg2	APN	12	116425906	critical splice donor site	probably null
IGL03073:Ncapg2	APN	12	116452274	missense	probably benign	0.01
IGL03114:Ncapg2	APN	12	116452373	splice site	probably benign
IGL03199:Ncapg2	APN	12	116419236	missense	probably damaging	1.00
IGL03328:Ncapg2	APN	12	116440057	missense	possibly damaging	0.90
P0033:Ncapg2	UTSW	12	116438635	missense	probably benign	0.03
R0008:Ncapg2	UTSW	12	116429835	missense	probably damaging	1.00
R0194:Ncapg2	UTSW	12	116420683	splice site	probably null
R0379:Ncapg2	UTSW	12	116443075	missense	probably damaging	1.00
R0771:Ncapg2	UTSW	12	116413159	nonsense	probably null
R1016:Ncapg2	UTSW	12	116438675	missense	probably damaging	1.00
R1507:Ncapg2	UTSW	12	116460566	missense	probably benign	0.00
R1524:Ncapg2	UTSW	12	116434578	splice site	probably benign
R1596:Ncapg2	UTSW	12	116419236	missense	probably damaging	1.00
R1635:Ncapg2	UTSW	12	116434685	frame shift	probably null
R1752:Ncapg2	UTSW	12	116426718	missense	probably damaging	1.00
R2164:Ncapg2	UTSW	12	116450475	splice site	probably null
R2266:Ncapg2	UTSW	12	116429676	missense	probably damaging	1.00
R2366:Ncapg2	UTSW	12	116420729	nonsense	probably null
R2924:Ncapg2	UTSW	12	116438729	missense	probably benign	0.03
R2925:Ncapg2	UTSW	12	116438729	missense	probably benign	0.03
R3828:Ncapg2	UTSW	12	116407318	splice site	probably benign
R3829:Ncapg2	UTSW	12	116407318	splice site	probably benign
R4384:Ncapg2	UTSW	12	116439877	critical splice donor site	probably null
R4651:Ncapg2	UTSW	12	116425787	missense	probably damaging	1.00
R4701:Ncapg2	UTSW	12	116440618	missense	probably benign
R4821:Ncapg2	UTSW	12	116415457	missense	probably damaging	0.99
R4845:Ncapg2	UTSW	12	116440588	missense	probably damaging	0.96
R5135:Ncapg2	UTSW	12	116427786	missense	possibly damaging	0.64
R5294:Ncapg2	UTSW	12	116427794	missense	possibly damaging	0.54
R5334:Ncapg2	UTSW	12	116426637	missense	probably damaging	1.00
R5588:Ncapg2	UTSW	12	116413077	missense	possibly damaging	0.95
R5888:Ncapg2	UTSW	12	116425800	missense	possibly damaging	0.84
R5938:Ncapg2	UTSW	12	116429657	missense	probably damaging	1.00
R5978:Ncapg2	UTSW	12	116424671	missense	possibly damaging	0.68
R6016:Ncapg2	UTSW	12	116426607	missense	probably damaging	1.00
R6026:Ncapg2	UTSW	12	116443021	missense	possibly damaging	0.73
R6155:Ncapg2	UTSW	12	116438011	missense	possibly damaging	0.83
R6509:Ncapg2	UTSW	12	116427756	missense	probably damaging	1.00
R6675:Ncapg2	UTSW	12	116434661	missense	possibly damaging	0.71
R6912:Ncapg2	UTSW	12	116426582	missense	probably benign
R7069:Ncapg2	UTSW	12	116424717	splice site	probably null
R7339:Ncapg2	UTSW	12	116414834	missense	probably damaging	0.96
R7440:Ncapg2	UTSW	12	116450413	missense	possibly damaging	0.89
R7445:Ncapg2	UTSW	12	116419268	missense	possibly damaging	0.50
R7704:Ncapg2	UTSW	12	116419277	missense	probably damaging	1.00
R8061:Ncapg2	UTSW	12	116426577	missense	probably benign
R8132:Ncapg2	UTSW	12	116444347	missense	possibly damaging	0.93
R8166:Ncapg2	UTSW	12	116412416	missense	probably benign	0.00
R8351:Ncapg2	UTSW	12	116440027	missense	possibly damaging	0.80
R8526:Ncapg2	UTSW	12	116440059	missense	probably benign	0.00
R8692:Ncapg2	UTSW	12	116450429	missense	probably damaging	1.00
R8739:Ncapg2	UTSW	12	116415478	missense	possibly damaging	0.75
R8766:Ncapg2	UTSW	12	116426736	missense	probably damaging	1.00
R8929:Ncapg2	UTSW	12	116452363	missense	probably damaging	1.00
R9046:Ncapg2	UTSW	12	116412525	missense	probably benign	0.01
R9187:Ncapg2	UTSW	12	116438667	missense	probably damaging	1.00
R9344:Ncapg2	UTSW	12	116424653	missense	probably damaging	1.00
R9444:Ncapg2	UTSW	12	116407243	missense	probably damaging	1.00
X0020:Ncapg2	UTSW	12	116424707	missense	probably damaging	1.00
Z1177:Ncapg2	UTSW	12	116438605	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AACAGCTCTGACAGAATAGCGGACG -3'
(R):5'- AGAGCCAGTAGCAGAACAAATTGCC -3'

Sequencing Primer
(F):5'- CTGACAGAATAGCGGACGTTTTC -3'
(R):5'- CTAAGAAATTCCTTTGACTGATGGGG -3'

Posted On

2013-06-11