Incidental Mutation 'R0568:Papd4'
ID 46274
Institutional Source Beutler Lab
Gene Symbol Papd4
Ensembl Gene ENSMUSG00000042167
Gene Name PAP associated domain containing 4
Synonyms 8030446C20Rik
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.451) question?
Stock # R0568 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 93146282-93192385 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93154992 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 381 (S381P)
Ref Sequence ENSEMBL: ENSMUSP00000048124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048702] [ENSMUST00000225868]
AlphaFold Q91YI6
Predicted Effect probably benign
Transcript: ENSMUST00000048702
AA Change: S381P

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000048124
Gene: ENSMUSG00000042167
AA Change: S381P

low complexity region 134 147 N/A INTRINSIC
Pfam:PAP_assoc 386 440 1.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223975
Predicted Effect probably benign
Transcript: ENSMUST00000225868
AA Change: S377P

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000226081
Meta Mutation Damage Score 0.0782 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele reuslts in disruption in polyadenylation in oocytes and somatic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in Papd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Papd4 APN 13 93186397 missense probably benign 0.01
IGL02312:Papd4 APN 13 93175533 missense probably benign
IGL02896:Papd4 APN 13 93168437 missense probably damaging 1.00
IGL02802:Papd4 UTSW 13 93148941 missense probably damaging 1.00
R0538:Papd4 UTSW 13 93175615 splice site probably benign
R0733:Papd4 UTSW 13 93155039 missense probably benign 0.05
R1136:Papd4 UTSW 13 93175697 critical splice donor site probably null
R1537:Papd4 UTSW 13 93175568 missense probably damaging 1.00
R1603:Papd4 UTSW 13 93175565 missense probably benign
R2508:Papd4 UTSW 13 93184218 missense probably damaging 1.00
R4920:Papd4 UTSW 13 93186325 nonsense probably null
R5881:Papd4 UTSW 13 93175738 nonsense probably null
R5916:Papd4 UTSW 13 93175547 missense probably damaging 1.00
R6333:Papd4 UTSW 13 93186313 nonsense probably null
R6783:Papd4 UTSW 13 93155018 missense probably benign 0.00
R6783:Papd4 UTSW 13 93155019 missense probably benign 0.00
R8162:Papd4 UTSW 13 93167924 critical splice donor site probably null
R8262:Papd4 UTSW 13 93174489 intron probably benign
R8264:Papd4 UTSW 13 93175569 missense probably damaging 1.00
R9124:Papd4 UTSW 13 93147652 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2013-06-11