Incidental Mutation 'R5770:Cgnl1'
ID462742
Institutional Source Beutler Lab
Gene Symbol Cgnl1
Ensembl Gene ENSMUSG00000032232
Gene Namecingulin-like 1
SynonymsJacop, 9930020M10Rik, 4933421H10Rik
MMRRC Submission 043370-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5770 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location71626509-71771602 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 71645487 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072899] [ENSMUST00000072899] [ENSMUST00000121322] [ENSMUST00000121322] [ENSMUST00000122065]
Predicted Effect probably null
Transcript: ENSMUST00000072899
SMART Domains Protein: ENSMUSP00000072672
Gene: ENSMUSG00000032232

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
Pfam:Myosin_tail_1 984 1255 5.4e-30 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000072899
SMART Domains Protein: ENSMUSP00000072672
Gene: ENSMUSG00000032232

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
Pfam:Myosin_tail_1 984 1255 5.4e-30 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121322
SMART Domains Protein: ENSMUSP00000113917
Gene: ENSMUSG00000032232

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
Pfam:Myosin_tail_1 909 1184 2.3e-30 PFAM
low complexity region 1187 1207 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121322
SMART Domains Protein: ENSMUSP00000113917
Gene: ENSMUSG00000032232

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
Pfam:Myosin_tail_1 909 1184 2.3e-30 PFAM
low complexity region 1187 1207 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000122065
SMART Domains Protein: ENSMUSP00000112479
Gene: ENSMUSG00000032232

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
Pfam:Myosin_tail_1 582 1034 1.3e-12 PFAM
Pfam:Myosin_tail_1 1011 1253 7.7e-38 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146567
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 93% (64/69)
MGI Phenotype FUNCTION: This gene encodes a protein localized to the tight junctions and adherens junctions in vertebrate epithelial cells. The encoded protein regulates the activity of Rho family GTPases during junction assembly and at confluence. At the adherens junctions, the encoded protein is part of a protein complex that links E-cadherin to the microtubule cytoskeleton. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030C10Rik T C 12: 20,815,459 noncoding transcript Het
Abhd8 A G 8: 71,457,328 V392A probably benign Het
AI481877 T C 4: 59,092,466 I238M probably benign Het
Alpk3 A G 7: 81,078,562 E480G probably benign Het
Ankfy1 C G 11: 72,760,256 H1011D probably damaging Het
Aoc3 T G 11: 101,331,752 Y271* probably null Het
Bcl9 T C 3: 97,215,175 I103V probably benign Het
Cyp2c23 T A 19: 44,021,579 D109V probably damaging Het
Cyp2j13 A T 4: 96,077,432 W13R probably benign Het
D630003M21Rik T C 2: 158,195,580 probably benign Het
Desi2 A T 1: 178,256,495 probably benign Het
Dll3 T C 7: 28,299,009 E177G possibly damaging Het
Ern2 C T 7: 122,179,907 G238D possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm6133 A G 18: 78,350,249 K153E probably benign Het
Gpr68 A T 12: 100,878,821 Y155N probably benign Het
Hcrtr2 T A 9: 76,259,666 I130F probably damaging Het
Hk1 T C 10: 62,286,449 K489R probably benign Het
Ints13 T C 6: 146,555,073 N425S probably damaging Het
Itpkc T C 7: 27,212,988 D578G probably damaging Het
Kcns3 A G 12: 11,092,249 S150P probably benign Het
Khdrbs3 T A 15: 69,049,463 probably null Het
Kif11 A G 19: 37,390,865 I335V probably benign Het
Lrrn4 C G 2: 132,872,156 C290S probably damaging Het
Macrod2 T C 2: 141,232,182 probably benign Het
Mgam A G 6: 40,669,804 N688S probably benign Het
Myh8 G A 11: 67,297,200 E933K probably damaging Het
Nat8f5 T C 6: 85,817,675 Y101C probably damaging Het
Nhlrc1 A G 13: 47,014,712 V23A probably benign Het
Nkx2-3 T A 19: 43,614,533 F193I probably damaging Het
Nlrp4b T A 7: 10,715,487 V172E probably benign Het
Nmrk1 G T 19: 18,645,074 R172S probably benign Het
Nudcd3 T C 11: 6,113,286 D201G probably damaging Het
Olfr1255 T A 2: 89,816,549 D68E probably damaging Het
Olfr1384 A G 11: 49,514,592 E318G unknown Het
Olfr205 A T 16: 59,329,151 Y119* probably null Het
Olfr314 G A 11: 58,786,594 R120H probably benign Het
Olfr46 A G 7: 140,610,943 Y259C probably damaging Het
Olfr679 A T 7: 105,090,895 I248N probably damaging Het
Olfr980 C T 9: 40,006,338 V204I probably benign Het
Oprm1 G A 10: 6,789,026 G51D probably damaging Het
Pcdh15 T A 10: 74,185,345 Y130* probably null Het
Pcdh9 G A 14: 93,886,943 T597I probably damaging Het
Pcdhb19 A G 18: 37,498,037 N295S possibly damaging Het
Pcnx3 T C 19: 5,681,579 probably benign Het
Pdzph1 A T 17: 58,879,151 I1215N probably damaging Het
Phf21a C T 2: 92,351,854 T405I possibly damaging Het
Pkd1l2 C A 8: 117,055,018 G763W probably damaging Het
Prox2 A G 12: 85,087,380 F591L probably benign Het
Robo3 T A 9: 37,419,201 H1033L possibly damaging Het
Sdha A T 13: 74,323,120 C222* probably null Het
Sec16a T C 2: 26,414,390 D2303G probably damaging Het
Slc16a5 A G 11: 115,472,778 K422E possibly damaging Het
Slc22a30 A T 19: 8,386,527 M232K probably damaging Het
Slc35b3 A T 13: 38,937,758 F300I probably damaging Het
Spata2l A G 8: 123,235,720 V34A probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tecta T A 9: 42,345,589 Q1597L possibly damaging Het
Tgfb1i1 A T 7: 128,248,547 probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tpm3-rs7 A G 14: 113,315,375 T234A probably benign Het
Usp20 A G 2: 31,017,508 Y684C probably damaging Het
Zc3h4 T A 7: 16,429,611 M585K unknown Het
Zfp292 A G 4: 34,806,747 I2099T probably damaging Het
Other mutations in Cgnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Cgnl1 APN 9 71656056 missense probably benign 0.00
IGL01128:Cgnl1 APN 9 71724561 missense possibly damaging 0.81
IGL01450:Cgnl1 APN 9 71631862 splice site probably benign
IGL01788:Cgnl1 APN 9 71655390 missense probably benign
IGL01806:Cgnl1 APN 9 71650322 missense probably damaging 0.99
IGL01906:Cgnl1 APN 9 71724567 missense probably benign 0.00
IGL01933:Cgnl1 APN 9 71645483 splice site probably benign
IGL01939:Cgnl1 APN 9 71725004 missense probably damaging 1.00
IGL01947:Cgnl1 APN 9 71725044 missense probably damaging 0.99
IGL02127:Cgnl1 APN 9 71725853 missense probably damaging 1.00
IGL02379:Cgnl1 APN 9 71645553 missense possibly damaging 0.82
IGL02510:Cgnl1 APN 9 71725357 missense probably benign 0.41
FR4548:Cgnl1 UTSW 9 71724717 small insertion probably benign
R0058:Cgnl1 UTSW 9 71641397 missense probably damaging 1.00
R0058:Cgnl1 UTSW 9 71724840 missense probably damaging 0.99
R0105:Cgnl1 UTSW 9 71656102 missense probably benign
R0220:Cgnl1 UTSW 9 71724943 missense possibly damaging 0.68
R0242:Cgnl1 UTSW 9 71721657 missense probably damaging 1.00
R0401:Cgnl1 UTSW 9 71705239 missense probably damaging 1.00
R0541:Cgnl1 UTSW 9 71651253 missense possibly damaging 0.54
R1018:Cgnl1 UTSW 9 71726058 missense probably damaging 1.00
R1026:Cgnl1 UTSW 9 71717431 missense possibly damaging 0.91
R1056:Cgnl1 UTSW 9 71725895 missense probably damaging 1.00
R1299:Cgnl1 UTSW 9 71721712 splice site probably benign
R1513:Cgnl1 UTSW 9 71724590 missense probably benign 0.02
R1546:Cgnl1 UTSW 9 71725815 missense probably benign
R1599:Cgnl1 UTSW 9 71641427 missense probably benign 0.02
R1657:Cgnl1 UTSW 9 71725944 missense probably damaging 0.98
R1970:Cgnl1 UTSW 9 71725535 missense probably benign 0.10
R2004:Cgnl1 UTSW 9 71630539 missense probably damaging 1.00
R2080:Cgnl1 UTSW 9 71656096 missense probably benign 0.01
R2085:Cgnl1 UTSW 9 71630878 missense probably damaging 1.00
R2357:Cgnl1 UTSW 9 71725668 nonsense probably null
R2402:Cgnl1 UTSW 9 71725179 missense probably damaging 1.00
R3954:Cgnl1 UTSW 9 71724663 missense probably benign 0.01
R4043:Cgnl1 UTSW 9 71705293 missense probably damaging 1.00
R4127:Cgnl1 UTSW 9 71724540 missense probably benign 0.00
R4825:Cgnl1 UTSW 9 71630524 missense probably benign 0.00
R4851:Cgnl1 UTSW 9 71725032 missense probably damaging 1.00
R4882:Cgnl1 UTSW 9 71717401 missense probably benign 0.00
R4996:Cgnl1 UTSW 9 71724826 small deletion probably benign
R5057:Cgnl1 UTSW 9 71724794 missense probably damaging 0.99
R5263:Cgnl1 UTSW 9 71632654 nonsense probably null
R5402:Cgnl1 UTSW 9 71629321 missense probably damaging 1.00
R5744:Cgnl1 UTSW 9 71630675 splice site probably null
R6911:Cgnl1 UTSW 9 71656215 missense possibly damaging 0.82
R7014:Cgnl1 UTSW 9 71725134 missense possibly damaging 0.86
R7106:Cgnl1 UTSW 9 71725733 missense probably benign 0.00
R7203:Cgnl1 UTSW 9 71724533 missense possibly damaging 0.80
R7231:Cgnl1 UTSW 9 71632645 missense probably benign 0.39
R7241:Cgnl1 UTSW 9 71724770 missense probably benign
R7288:Cgnl1 UTSW 9 71725564 missense possibly damaging 0.67
R7327:Cgnl1 UTSW 9 71725883 missense possibly damaging 0.48
R7390:Cgnl1 UTSW 9 71645649 missense probably benign 0.04
R7529:Cgnl1 UTSW 9 71631758 missense probably damaging 1.00
R7793:Cgnl1 UTSW 9 71725635 missense probably damaging 1.00
R7975:Cgnl1 UTSW 9 71725322 missense probably benign 0.00
R7990:Cgnl1 UTSW 9 71725265 missense probably damaging 1.00
R8502:Cgnl1 UTSW 9 71630605 missense probably damaging 0.99
RF015:Cgnl1 UTSW 9 71724715 small insertion probably benign
RF042:Cgnl1 UTSW 9 71724715 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCACTCCAAAGAAAGGGTCTTG -3'
(R):5'- CCTTCTAGTTACGCCTCAAGG -3'

Sequencing Primer
(F):5'- CACTCCAAAGAAAGGGTCTTGATTAC -3'
(R):5'- GAGGAAGAGTTGCAGGACTACC -3'
Posted On2017-03-01