Incidental Mutation 'R5699:Ikbke'
ID462744
Institutional Source Beutler Lab
Gene Symbol Ikbke
Ensembl Gene ENSMUSG00000042349
Gene Nameinhibitor of kappaB kinase epsilon
SynonymsIKK-i, IKKepsilon
MMRRC Submission 043327-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5699 (G1)
Quality Score216
Status Not validated
Chromosome1
Chromosomal Location131254343-131279606 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 131276467 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062108] [ENSMUST00000159195] [ENSMUST00000161764]
Predicted Effect probably null
Transcript: ENSMUST00000062108
SMART Domains Protein: ENSMUSP00000054126
Gene: ENSMUSG00000042349

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 249 1.1e-29 PFAM
Pfam:Pkinase 9 301 6.7e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159195
SMART Domains Protein: ENSMUSP00000124486
Gene: ENSMUSG00000042349

DomainStartEndE-ValueType
Pfam:Pkinase 9 130 2.2e-23 PFAM
Pfam:Pkinase_Tyr 9 130 2.1e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161764
SMART Domains Protein: ENSMUSP00000124190
Gene: ENSMUSG00000042349

DomainStartEndE-ValueType
Pfam:Pkinase 49 278 9.3e-31 PFAM
Pfam:Pkinase_Tyr 50 226 5.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162285
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IKBKE is a noncanonical I-kappa-B (see MIM 164008) kinase (IKK) that is essential for regulating antiviral signaling pathways. IKBKE has also been identified as a breast cancer (MIM 114480) oncogene and is amplified and overexpressed in over 30% of breast carcinomas and breast cancer cell lines (Hutti et al., 2009 [PubMed 19481526]).[supplied by OMIM, Oct 2009]
PHENOTYPE: Homozygous null mice are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,225,319 noncoding transcript Het
4930486L24Rik A G 13: 60,853,596 F106L possibly damaging Het
Adam11 A T 11: 102,773,640 M385L probably benign Het
Adgre1 C T 17: 57,481,007 P925S probably benign Het
Adh7 G A 3: 138,226,326 A234T probably benign Het
Ano2 A G 6: 125,872,740 E475G probably damaging Het
BC055324 A T 1: 163,957,551 V753D probably benign Het
C2cd4c A G 10: 79,612,551 V254A probably benign Het
Car13 A G 3: 14,650,689 Y89C probably damaging Het
Cd38 A G 5: 43,900,386 K100R probably damaging Het
Cdh11 A G 8: 102,634,543 I721T probably damaging Het
Cdh2 G A 18: 16,646,522 Q161* probably null Het
Clk1 T C 1: 58,420,195 K135R probably damaging Het
Col5a1 G A 2: 27,997,599 G961R unknown Het
Cpt1b T A 15: 89,424,273 I151F probably benign Het
Cyp51 A G 5: 4,101,213 F139L probably damaging Het
Disp1 TTGA T 1: 183,088,555 probably null Het
Dnah8 T C 17: 30,810,324 I4089T probably benign Het
Dnali1 C T 4: 125,059,050 V227M possibly damaging Het
Eml4 T G 17: 83,410,085 S29A probably benign Het
Eps8l3 C A 3: 107,879,579 P24T probably benign Het
Fancc A T 13: 63,330,632 probably null Het
Grid2 G A 6: 63,908,991 A124T probably damaging Het
Kyat1 G A 2: 30,186,650 A284V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmbrd2 G T 15: 9,175,182 L393F probably benign Het
Lrrc26 T A 2: 25,290,524 L179Q probably damaging Het
Mlx A G 11: 101,088,694 D113G possibly damaging Het
Myod1 A G 7: 46,376,983 K104R probably damaging Het
Nwd1 G A 8: 72,702,974 probably null Het
Olfr1474 A G 19: 13,470,972 M1V probably null Het
Olfr663 T G 7: 104,703,993 V142G probably damaging Het
Olfr788 A C 10: 129,472,877 N62H probably damaging Het
Pacsin3 A T 2: 91,262,781 Y206F probably damaging Het
Pcdhgb5 T A 18: 37,731,917 V255E probably damaging Het
Pdp1 T C 4: 11,960,907 D468G possibly damaging Het
Pgr C T 9: 8,900,599 probably benign Het
Prrt2 T A 7: 127,018,727 Y345F probably benign Het
Rbbp8nl T C 2: 180,278,668 T515A probably damaging Het
Rc3h1 G T 1: 160,930,253 R47L probably damaging Het
Rfpl4b T A 10: 38,821,285 I107F possibly damaging Het
Rsbn1 T C 3: 103,962,485 F754S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn3a T C 2: 65,507,264 T630A possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slco1a5 C A 6: 142,248,816 C367F probably damaging Het
Slit1 A G 19: 41,625,520 probably null Het
Slit2 G A 5: 48,220,991 probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Stk16 T A 1: 75,213,604 M111K probably damaging Het
Tbc1d2 T C 4: 46,616,298 I477V probably benign Het
Tll1 T A 8: 64,117,940 E199D probably damaging Het
Trhde A T 10: 114,588,502 D459E probably benign Het
Ttn T C 2: 76,711,537 R25375G possibly damaging Het
Tubgcp2 A T 7: 139,998,788 M757K possibly damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ubqln5 A G 7: 104,129,425 V64A possibly damaging Het
Usp47 A G 7: 112,109,997 M1337V probably benign Het
Vmn1r201 T A 13: 22,475,239 Y208N probably damaging Het
Xkr8 C T 4: 132,728,057 R335H probably damaging Het
Zbtb49 A T 5: 38,216,526 C25S probably damaging Het
Zeb2 T A 2: 44,997,788 N404I probably damaging Het
Other mutations in Ikbke
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ikbke APN 1 131270012 splice site probably null
IGL00703:Ikbke APN 1 131255302 utr 3 prime probably benign
IGL01079:Ikbke APN 1 131265647 missense possibly damaging 0.64
IGL01106:Ikbke APN 1 131260055 splice site probably benign
IGL01336:Ikbke APN 1 131273756 missense probably damaging 1.00
IGL01505:Ikbke APN 1 131255311 missense probably benign 0.00
IGL01564:Ikbke APN 1 131257921 missense probably benign 0.37
IGL01568:Ikbke APN 1 131257896 splice site probably null
IGL01668:Ikbke APN 1 131256938 missense probably benign 0.05
IGL01977:Ikbke APN 1 131272101 splice site probably benign
IGL02162:Ikbke APN 1 131273715 missense possibly damaging 0.69
IGL02653:Ikbke APN 1 131271835 missense possibly damaging 0.89
IGL02859:Ikbke APN 1 131270197 missense probably damaging 0.97
R0028:Ikbke UTSW 1 131272184 missense possibly damaging 0.87
R0427:Ikbke UTSW 1 131257910 missense possibly damaging 0.62
R0607:Ikbke UTSW 1 131270184 critical splice donor site probably null
R1295:Ikbke UTSW 1 131270226 missense probably benign 0.03
R1470:Ikbke UTSW 1 131276487 missense probably null 1.00
R1470:Ikbke UTSW 1 131276487 missense probably null 1.00
R1720:Ikbke UTSW 1 131259210 missense possibly damaging 0.94
R1728:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1728:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1729:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1729:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1730:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1730:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1739:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1739:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1748:Ikbke UTSW 1 131259200 missense probably benign 0.02
R1762:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1762:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1763:Ikbke UTSW 1 131265877 missense probably benign 0.01
R1783:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1783:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1784:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1784:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1785:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1785:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1794:Ikbke UTSW 1 131259218 missense probably damaging 1.00
R2143:Ikbke UTSW 1 131273474 missense probably damaging 0.98
R2144:Ikbke UTSW 1 131273474 missense probably damaging 0.98
R2145:Ikbke UTSW 1 131273474 missense probably damaging 0.98
R2386:Ikbke UTSW 1 131259266 missense probably damaging 1.00
R2893:Ikbke UTSW 1 131270224 missense probably damaging 1.00
R4210:Ikbke UTSW 1 131263348 missense probably damaging 0.97
R4211:Ikbke UTSW 1 131263348 missense probably damaging 0.97
R4284:Ikbke UTSW 1 131275778 critical splice donor site probably null
R4461:Ikbke UTSW 1 131265922 missense probably benign
R4551:Ikbke UTSW 1 131258033 intron probably benign
R4560:Ikbke UTSW 1 131272120 missense probably damaging 1.00
R4849:Ikbke UTSW 1 131275267 frame shift probably null
R4855:Ikbke UTSW 1 131257111 splice site probably null
R4876:Ikbke UTSW 1 131275267 frame shift probably null
R4879:Ikbke UTSW 1 131275267 frame shift probably null
R4967:Ikbke UTSW 1 131275267 frame shift probably null
R4968:Ikbke UTSW 1 131275267 frame shift probably null
R4971:Ikbke UTSW 1 131275267 frame shift probably null
R5020:Ikbke UTSW 1 131273660 missense probably damaging 1.00
R5814:Ikbke UTSW 1 131271779 missense probably damaging 0.96
R6392:Ikbke UTSW 1 131275146 splice site probably null
R6492:Ikbke UTSW 1 131259218 missense probably damaging 1.00
R6899:Ikbke UTSW 1 131275762 missense probably damaging 1.00
R7552:Ikbke UTSW 1 131272150 nonsense probably null
R7583:Ikbke UTSW 1 131276479 missense probably damaging 0.99
R7652:Ikbke UTSW 1 131271832 missense probably damaging 1.00
R7806:Ikbke UTSW 1 131271898 missense probably damaging 1.00
R7984:Ikbke UTSW 1 131275786 missense probably null 1.00
R8211:Ikbke UTSW 1 131271778 missense probably damaging 0.96
R8309:Ikbke UTSW 1 131263328 nonsense probably null
X0026:Ikbke UTSW 1 131257986 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTAGTCCCAACATGCCTCTGAC -3'
(R):5'- TGGCTGGCTATCAGTGTCTAC -3'

Sequencing Primer
(F):5'- GAGGCACCATTCCAAGGAATTTTTC -3'
(R):5'- CAGTGTCTACTGCAGGTAAGAC -3'
Posted On2017-03-01