Incidental Mutation 'R5699:Nwd1'
ID462746
Institutional Source Beutler Lab
Gene Symbol Nwd1
Ensembl Gene ENSMUSG00000048148
Gene NameNACHT and WD repeat domain containing 1
SynonymsA230063L24Rik
MMRRC Submission 043327-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5699 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72646711-72717876 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 72702974 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093427] [ENSMUST00000093427] [ENSMUST00000160443] [ENSMUST00000161254] [ENSMUST00000161254] [ENSMUST00000161557] [ENSMUST00000228312]
Predicted Effect probably null
Transcript: ENSMUST00000093427
SMART Domains Protein: ENSMUSP00000091135
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
Pfam:AAA_16 312 457 7.3e-8 PFAM
Pfam:NACHT 336 511 1.3e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 2e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 4e-10 BLAST
WD40 1118 1156 5.97e-1 SMART
WD40 1160 1198 6.6e1 SMART
WD40 1245 1283 5.3e1 SMART
WD40 1286 1326 2.13e1 SMART
WD40 1340 1375 1.06e2 SMART
WD40 1377 1416 3.5e-4 SMART
WD40 1421 1461 2.66e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093427
SMART Domains Protein: ENSMUSP00000091135
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
Pfam:AAA_16 312 457 7.3e-8 PFAM
Pfam:NACHT 336 511 1.3e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 2e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 4e-10 BLAST
WD40 1118 1156 5.97e-1 SMART
WD40 1160 1198 6.6e1 SMART
WD40 1245 1283 5.3e1 SMART
WD40 1286 1326 2.13e1 SMART
WD40 1340 1375 1.06e2 SMART
WD40 1377 1416 3.5e-4 SMART
WD40 1421 1461 2.66e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160443
SMART Domains Protein: ENSMUSP00000124446
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160912
Predicted Effect probably null
Transcript: ENSMUST00000161254
SMART Domains Protein: ENSMUSP00000124804
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 2.1e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 1e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 3e-10 BLAST
WD40 1118 1156 2.49e-1 SMART
WD40 1203 1241 5.3e1 SMART
WD40 1244 1284 2.13e1 SMART
WD40 1298 1333 1.06e2 SMART
WD40 1335 1374 3.5e-4 SMART
WD40 1379 1419 2.66e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161254
SMART Domains Protein: ENSMUSP00000124804
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 2.1e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 1e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 3e-10 BLAST
WD40 1118 1156 2.49e-1 SMART
WD40 1203 1241 5.3e1 SMART
WD40 1244 1284 2.13e1 SMART
WD40 1298 1333 1.06e2 SMART
WD40 1335 1374 3.5e-4 SMART
WD40 1379 1419 2.66e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161557
SMART Domains Protein: ENSMUSP00000125470
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163026
Predicted Effect probably null
Transcript: ENSMUST00000228312
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a cytosolic protein and predicted to contain a NACHT domain and multiple WD40 repeats. Increased expression of this gene was observed in some prostate cancer cell lines. Knocking down expression of this gene results in decreased androgen receptor protein levels, indicating that this gene may be important in modulating androgen receptor activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,225,319 noncoding transcript Het
4930486L24Rik A G 13: 60,853,596 F106L possibly damaging Het
Adam11 A T 11: 102,773,640 M385L probably benign Het
Adgre1 C T 17: 57,481,007 P925S probably benign Het
Adh7 G A 3: 138,226,326 A234T probably benign Het
Ano2 A G 6: 125,872,740 E475G probably damaging Het
BC055324 A T 1: 163,957,551 V753D probably benign Het
C2cd4c A G 10: 79,612,551 V254A probably benign Het
Car13 A G 3: 14,650,689 Y89C probably damaging Het
Cd38 A G 5: 43,900,386 K100R probably damaging Het
Cdh11 A G 8: 102,634,543 I721T probably damaging Het
Cdh2 G A 18: 16,646,522 Q161* probably null Het
Clk1 T C 1: 58,420,195 K135R probably damaging Het
Col5a1 G A 2: 27,997,599 G961R unknown Het
Cpt1b T A 15: 89,424,273 I151F probably benign Het
Cyp51 A G 5: 4,101,213 F139L probably damaging Het
Disp1 TTGA T 1: 183,088,555 probably null Het
Dnah8 T C 17: 30,810,324 I4089T probably benign Het
Dnali1 C T 4: 125,059,050 V227M possibly damaging Het
Eml4 T G 17: 83,410,085 S29A probably benign Het
Eps8l3 C A 3: 107,879,579 P24T probably benign Het
Fancc A T 13: 63,330,632 probably null Het
Grid2 G A 6: 63,908,991 A124T probably damaging Het
Ikbke C T 1: 131,276,467 probably null Het
Kyat1 G A 2: 30,186,650 A284V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmbrd2 G T 15: 9,175,182 L393F probably benign Het
Lrrc26 T A 2: 25,290,524 L179Q probably damaging Het
Mlx A G 11: 101,088,694 D113G possibly damaging Het
Myod1 A G 7: 46,376,983 K104R probably damaging Het
Olfr1474 A G 19: 13,470,972 M1V probably null Het
Olfr663 T G 7: 104,703,993 V142G probably damaging Het
Olfr788 A C 10: 129,472,877 N62H probably damaging Het
Pacsin3 A T 2: 91,262,781 Y206F probably damaging Het
Pcdhgb5 T A 18: 37,731,917 V255E probably damaging Het
Pdp1 T C 4: 11,960,907 D468G possibly damaging Het
Pgr C T 9: 8,900,599 probably benign Het
Prrt2 T A 7: 127,018,727 Y345F probably benign Het
Rbbp8nl T C 2: 180,278,668 T515A probably damaging Het
Rc3h1 G T 1: 160,930,253 R47L probably damaging Het
Rfpl4b T A 10: 38,821,285 I107F possibly damaging Het
Rsbn1 T C 3: 103,962,485 F754S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn3a T C 2: 65,507,264 T630A possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slco1a5 C A 6: 142,248,816 C367F probably damaging Het
Slit1 A G 19: 41,625,520 probably null Het
Slit2 G A 5: 48,220,991 probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Stk16 T A 1: 75,213,604 M111K probably damaging Het
Tbc1d2 T C 4: 46,616,298 I477V probably benign Het
Tll1 T A 8: 64,117,940 E199D probably damaging Het
Trhde A T 10: 114,588,502 D459E probably benign Het
Ttn T C 2: 76,711,537 R25375G possibly damaging Het
Tubgcp2 A T 7: 139,998,788 M757K possibly damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ubqln5 A G 7: 104,129,425 V64A possibly damaging Het
Usp47 A G 7: 112,109,997 M1337V probably benign Het
Vmn1r201 T A 13: 22,475,239 Y208N probably damaging Het
Xkr8 C T 4: 132,728,057 R335H probably damaging Het
Zbtb49 A T 5: 38,216,526 C25S probably damaging Het
Zeb2 T A 2: 44,997,788 N404I probably damaging Het
Other mutations in Nwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Nwd1 APN 8 72671077 missense probably damaging 0.99
IGL01294:Nwd1 APN 8 72711745 missense probably damaging 1.00
IGL01298:Nwd1 APN 8 72662331 missense probably benign 0.00
IGL01333:Nwd1 APN 8 72666811 missense possibly damaging 0.90
IGL01371:Nwd1 APN 8 72675115 missense probably damaging 1.00
IGL02244:Nwd1 APN 8 72707582 missense probably damaging 1.00
IGL02579:Nwd1 APN 8 72707527 missense probably damaging 1.00
IGL02608:Nwd1 APN 8 72667375 missense probably damaging 1.00
IGL02632:Nwd1 APN 8 72667454 missense possibly damaging 0.80
IGL02893:Nwd1 APN 8 72667501 missense probably damaging 1.00
IGL03010:Nwd1 APN 8 72688060 splice site probably benign
R0017:Nwd1 UTSW 8 72709425 splice site probably benign
R0066:Nwd1 UTSW 8 72711856 missense probably benign 0.27
R0066:Nwd1 UTSW 8 72711856 missense probably benign 0.27
R0505:Nwd1 UTSW 8 72662337 missense probably damaging 0.96
R0511:Nwd1 UTSW 8 72682005 missense probably damaging 1.00
R0612:Nwd1 UTSW 8 72667680 missense probably damaging 0.99
R0681:Nwd1 UTSW 8 72662337 missense probably damaging 0.96
R0763:Nwd1 UTSW 8 72671044 missense probably damaging 1.00
R0905:Nwd1 UTSW 8 72709449 missense probably damaging 0.99
R1136:Nwd1 UTSW 8 72697769 splice site probably benign
R1483:Nwd1 UTSW 8 72657086 missense probably damaging 0.96
R1630:Nwd1 UTSW 8 72667029 missense possibly damaging 0.66
R1724:Nwd1 UTSW 8 72711620 missense probably damaging 1.00
R1732:Nwd1 UTSW 8 72666835 missense possibly damaging 0.96
R1885:Nwd1 UTSW 8 72704994 missense probably benign 0.00
R1973:Nwd1 UTSW 8 72704962 missense possibly damaging 0.46
R2393:Nwd1 UTSW 8 72662427 missense probably benign
R2926:Nwd1 UTSW 8 72667012 missense probably damaging 1.00
R3706:Nwd1 UTSW 8 72667116 missense possibly damaging 0.66
R3916:Nwd1 UTSW 8 72667811 nonsense probably null
R3917:Nwd1 UTSW 8 72667811 nonsense probably null
R4153:Nwd1 UTSW 8 72681936 missense probably damaging 1.00
R4426:Nwd1 UTSW 8 72666795 missense probably damaging 1.00
R4435:Nwd1 UTSW 8 72688136 missense possibly damaging 0.46
R4522:Nwd1 UTSW 8 72670951 missense probably damaging 1.00
R4622:Nwd1 UTSW 8 72667300 missense probably damaging 1.00
R4659:Nwd1 UTSW 8 72695321 missense probably benign 0.03
R4694:Nwd1 UTSW 8 72667330 missense probably damaging 1.00
R4837:Nwd1 UTSW 8 72657131 missense probably damaging 1.00
R4844:Nwd1 UTSW 8 72667114 missense probably damaging 1.00
R4906:Nwd1 UTSW 8 72672213 missense probably damaging 1.00
R5041:Nwd1 UTSW 8 72705055 missense possibly damaging 0.90
R5183:Nwd1 UTSW 8 72671086 missense probably benign 0.07
R5416:Nwd1 UTSW 8 72666694 missense possibly damaging 0.90
R5553:Nwd1 UTSW 8 72704976 missense possibly damaging 0.83
R5670:Nwd1 UTSW 8 72693117 missense probably damaging 0.97
R5722:Nwd1 UTSW 8 72675244 missense probably damaging 0.97
R5762:Nwd1 UTSW 8 72670914 missense probably damaging 1.00
R5778:Nwd1 UTSW 8 72693117 missense probably damaging 0.97
R5992:Nwd1 UTSW 8 72653573 critical splice donor site probably null
R6163:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6164:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6165:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6212:Nwd1 UTSW 8 72695322 missense possibly damaging 0.95
R6443:Nwd1 UTSW 8 72662366 missense possibly damaging 0.58
R6865:Nwd1 UTSW 8 72657062 missense possibly damaging 0.63
R6928:Nwd1 UTSW 8 72682025 missense probably benign 0.27
R6944:Nwd1 UTSW 8 72653534 missense possibly damaging 0.69
R6979:Nwd1 UTSW 8 72667660 missense probably damaging 1.00
R7060:Nwd1 UTSW 8 72666694 missense probably damaging 1.00
R7102:Nwd1 UTSW 8 72695329 missense probably damaging 1.00
R7265:Nwd1 UTSW 8 72692928 missense probably benign 0.29
R7343:Nwd1 UTSW 8 72711782 missense probably damaging 0.98
R7391:Nwd1 UTSW 8 72662418 missense probably damaging 0.99
R7424:Nwd1 UTSW 8 72675173 missense possibly damaging 0.86
R7438:Nwd1 UTSW 8 72707830 missense probably benign 0.00
R7487:Nwd1 UTSW 8 72666638 missense unknown
R7502:Nwd1 UTSW 8 72707393 missense probably damaging 0.98
R7883:Nwd1 UTSW 8 72667126 missense probably damaging 1.00
R8235:Nwd1 UTSW 8 72711686 frame shift probably null
R8235:Nwd1 UTSW 8 72711689 frame shift probably null
R8282:Nwd1 UTSW 8 72704952 missense probably damaging 0.99
X0067:Nwd1 UTSW 8 72667256 missense possibly damaging 0.81
Z1176:Nwd1 UTSW 8 72672300 missense not run
Z1177:Nwd1 UTSW 8 72666628 missense probably damaging 0.97
Z1177:Nwd1 UTSW 8 72695387 missense possibly damaging 0.48
Z1177:Nwd1 UTSW 8 72709459 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCATGGGTTGAGTAACTGC -3'
(R):5'- GCCTGCTTTGTGAAACATTCC -3'

Sequencing Primer
(F):5'- GAGTAACTGCTCTCAGGCTCTG -3'
(R):5'- GTGAAACATTCCAGGTCTGC -3'
Posted On2017-03-01