Incidental Mutation 'R5699:Slit1'
ID462747
Institutional Source Beutler Lab
Gene Symbol Slit1
Ensembl Gene ENSMUSG00000025020
Gene Nameslit guidance ligand 1
SynonymsSlil1
MMRRC Submission 043327-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5699 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41600257-41743665 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 41625520 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025993] [ENSMUST00000166496] [ENSMUST00000169141]
Predicted Effect probably null
Transcript: ENSMUST00000025993
SMART Domains Protein: ENSMUSP00000025993
Gene: ENSMUSG00000025020

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
FOLN 1418 1440 2.25e1 SMART
EGF 1418 1451 1.28e-3 SMART
CT 1462 1531 3.15e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166496
SMART Domains Protein: ENSMUSP00000128381
Gene: ENSMUSG00000025020

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
low complexity region 1437 1458 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169141
SMART Domains Protein: ENSMUSP00000129034
Gene: ENSMUSG00000025020

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
FOLN 1418 1440 2.25e1 SMART
EGF 1418 1451 1.28e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit normal interneuron numbers and morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,225,319 noncoding transcript Het
4930486L24Rik A G 13: 60,853,596 F106L possibly damaging Het
Adam11 A T 11: 102,773,640 M385L probably benign Het
Adgre1 C T 17: 57,481,007 P925S probably benign Het
Adh7 G A 3: 138,226,326 A234T probably benign Het
Ano2 A G 6: 125,872,740 E475G probably damaging Het
BC055324 A T 1: 163,957,551 V753D probably benign Het
C2cd4c A G 10: 79,612,551 V254A probably benign Het
Car13 A G 3: 14,650,689 Y89C probably damaging Het
Cd38 A G 5: 43,900,386 K100R probably damaging Het
Cdh11 A G 8: 102,634,543 I721T probably damaging Het
Cdh2 G A 18: 16,646,522 Q161* probably null Het
Clk1 T C 1: 58,420,195 K135R probably damaging Het
Col5a1 G A 2: 27,997,599 G961R unknown Het
Cpt1b T A 15: 89,424,273 I151F probably benign Het
Cyp51 A G 5: 4,101,213 F139L probably damaging Het
Disp1 TTGA T 1: 183,088,555 probably null Het
Dnah8 T C 17: 30,810,324 I4089T probably benign Het
Dnali1 C T 4: 125,059,050 V227M possibly damaging Het
Eml4 T G 17: 83,410,085 S29A probably benign Het
Eps8l3 C A 3: 107,879,579 P24T probably benign Het
Fancc A T 13: 63,330,632 probably null Het
Grid2 G A 6: 63,908,991 A124T probably damaging Het
Ikbke C T 1: 131,276,467 probably null Het
Kyat1 G A 2: 30,186,650 A284V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmbrd2 G T 15: 9,175,182 L393F probably benign Het
Lrrc26 T A 2: 25,290,524 L179Q probably damaging Het
Mlx A G 11: 101,088,694 D113G possibly damaging Het
Myod1 A G 7: 46,376,983 K104R probably damaging Het
Nwd1 G A 8: 72,702,974 probably null Het
Olfr1474 A G 19: 13,470,972 M1V probably null Het
Olfr663 T G 7: 104,703,993 V142G probably damaging Het
Olfr788 A C 10: 129,472,877 N62H probably damaging Het
Pacsin3 A T 2: 91,262,781 Y206F probably damaging Het
Pcdhgb5 T A 18: 37,731,917 V255E probably damaging Het
Pdp1 T C 4: 11,960,907 D468G possibly damaging Het
Pgr C T 9: 8,900,599 probably benign Het
Prrt2 T A 7: 127,018,727 Y345F probably benign Het
Rbbp8nl T C 2: 180,278,668 T515A probably damaging Het
Rc3h1 G T 1: 160,930,253 R47L probably damaging Het
Rfpl4b T A 10: 38,821,285 I107F possibly damaging Het
Rsbn1 T C 3: 103,962,485 F754S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn3a T C 2: 65,507,264 T630A possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slco1a5 C A 6: 142,248,816 C367F probably damaging Het
Slit2 G A 5: 48,220,991 probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Stk16 T A 1: 75,213,604 M111K probably damaging Het
Tbc1d2 T C 4: 46,616,298 I477V probably benign Het
Tll1 T A 8: 64,117,940 E199D probably damaging Het
Trhde A T 10: 114,588,502 D459E probably benign Het
Ttn T C 2: 76,711,537 R25375G possibly damaging Het
Tubgcp2 A T 7: 139,998,788 M757K possibly damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ubqln5 A G 7: 104,129,425 V64A possibly damaging Het
Usp47 A G 7: 112,109,997 M1337V probably benign Het
Vmn1r201 T A 13: 22,475,239 Y208N probably damaging Het
Xkr8 C T 4: 132,728,057 R335H probably damaging Het
Zbtb49 A T 5: 38,216,526 C25S probably damaging Het
Zeb2 T A 2: 44,997,788 N404I probably damaging Het
Other mutations in Slit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Slit1 APN 19 41650835 missense probably damaging 1.00
IGL00515:Slit1 APN 19 41624501 missense probably damaging 0.97
IGL00909:Slit1 APN 19 41602255 missense possibly damaging 0.89
IGL00953:Slit1 APN 19 41602300 missense probably damaging 1.00
IGL01116:Slit1 APN 19 41606385 missense possibly damaging 0.93
IGL01457:Slit1 APN 19 41611044 missense probably damaging 1.00
IGL01688:Slit1 APN 19 41729106 missense probably damaging 1.00
IGL01720:Slit1 APN 19 41634214 missense probably benign 0.01
IGL01925:Slit1 APN 19 41608378 missense probably damaging 0.98
IGL02008:Slit1 APN 19 41646140 missense probably damaging 0.99
IGL02312:Slit1 APN 19 41601680 missense possibly damaging 0.66
IGL02398:Slit1 APN 19 41602237 missense probably damaging 1.00
IGL02542:Slit1 APN 19 41627248 missense probably damaging 1.00
IGL02559:Slit1 APN 19 41721085 missense probably benign 0.01
IGL02609:Slit1 APN 19 41602304 missense probably damaging 0.99
IGL02623:Slit1 APN 19 41651683 missense probably damaging 0.98
IGL02729:Slit1 APN 19 41603334 missense probably damaging 1.00
IGL03230:Slit1 APN 19 41729085 missense probably damaging 1.00
IGL03387:Slit1 APN 19 41603442 missense possibly damaging 0.57
PIT4576001:Slit1 UTSW 19 41624549 missense possibly damaging 0.52
R0366:Slit1 UTSW 19 41611031 missense probably damaging 1.00
R0432:Slit1 UTSW 19 41743293 missense probably damaging 0.98
R0496:Slit1 UTSW 19 41608311 splice site probably benign
R0722:Slit1 UTSW 19 41608435 missense probably damaging 1.00
R1468:Slit1 UTSW 19 41608384 missense probably damaging 1.00
R1468:Slit1 UTSW 19 41608384 missense probably damaging 1.00
R1488:Slit1 UTSW 19 41608385 missense probably damaging 1.00
R1615:Slit1 UTSW 19 41650671 splice site probably benign
R1694:Slit1 UTSW 19 41637592 missense possibly damaging 0.69
R1762:Slit1 UTSW 19 41603335 missense probably damaging 1.00
R1842:Slit1 UTSW 19 41721038 critical splice donor site probably null
R1844:Slit1 UTSW 19 41625573 missense probably damaging 1.00
R1940:Slit1 UTSW 19 41630776 missense probably damaging 1.00
R2087:Slit1 UTSW 19 41637483 missense probably benign 0.00
R2094:Slit1 UTSW 19 41606380 missense probably damaging 0.99
R2095:Slit1 UTSW 19 41606380 missense probably damaging 0.99
R2104:Slit1 UTSW 19 41602247 missense possibly damaging 0.69
R2305:Slit1 UTSW 19 41611016 missense probably benign 0.03
R2972:Slit1 UTSW 19 41611016 missense probably benign 0.03
R2973:Slit1 UTSW 19 41611016 missense probably benign 0.03
R2974:Slit1 UTSW 19 41611016 missense probably benign 0.03
R3159:Slit1 UTSW 19 41604373 missense probably benign
R3752:Slit1 UTSW 19 41646967 critical splice donor site probably null
R4095:Slit1 UTSW 19 41608486 intron probably benign
R4282:Slit1 UTSW 19 41614417 missense probably benign
R4417:Slit1 UTSW 19 41614469 missense probably damaging 1.00
R4607:Slit1 UTSW 19 41616793 missense probably benign 0.10
R4729:Slit1 UTSW 19 41647020 missense probably damaging 1.00
R4756:Slit1 UTSW 19 41649013 missense probably damaging 1.00
R4764:Slit1 UTSW 19 41721044 nonsense probably null
R4849:Slit1 UTSW 19 41649544 missense probably benign 0.17
R4874:Slit1 UTSW 19 41729054 critical splice donor site probably null
R5581:Slit1 UTSW 19 41616663 critical splice donor site probably null
R5888:Slit1 UTSW 19 41743296 missense probably damaging 1.00
R5906:Slit1 UTSW 19 41606374 missense probably damaging 1.00
R6176:Slit1 UTSW 19 41637595 missense probably damaging 1.00
R6277:Slit1 UTSW 19 41600509 missense possibly damaging 0.81
R6702:Slit1 UTSW 19 41614870 missense possibly damaging 0.95
R6860:Slit1 UTSW 19 41616715 missense probably benign 0.10
R7015:Slit1 UTSW 19 41629886 nonsense probably null
R7172:Slit1 UTSW 19 41634666 missense probably damaging 1.00
R7512:Slit1 UTSW 19 41600635 missense probably damaging 1.00
R7568:Slit1 UTSW 19 41601635 missense probably damaging 1.00
R7614:Slit1 UTSW 19 41634200 missense probably damaging 1.00
R7650:Slit1 UTSW 19 41629924 missense probably damaging 1.00
R7687:Slit1 UTSW 19 41650689 missense probably benign 0.03
R7732:Slit1 UTSW 19 41604408 missense probably benign 0.01
R7947:Slit1 UTSW 19 41610808 missense probably damaging 1.00
R7947:Slit1 UTSW 19 41610809 missense probably benign
R8171:Slit1 UTSW 19 41727073 missense probably damaging 0.97
R8217:Slit1 UTSW 19 41624520 missense possibly damaging 0.60
X0023:Slit1 UTSW 19 41601640 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGATGATGGTCACCTCTTGG -3'
(R):5'- TGGGCTCTAGAAATACAACCC -3'

Sequencing Primer
(F):5'- TGGCTCATTTCCTATGCATAGC -3'
(R):5'- GGGCTCTAGAAATACAACCCTAATAC -3'
Posted On2017-03-01