Mutagenetix > Incidental Mutations

Incidental Mutation 'R0568:Polr3d'

46275

Institutional Source

Beutler Lab

Gene Symbol

Polr3d

Ensembl Gene

ENSMUSG00000000776

Gene Name

polymerase (RNA) III (DNA directed) polypeptide D

Synonyms

TSBN51, RPC4, 44kDa, 2810426M17Rik, BN51T

MMRRC Submission

038759-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R0568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70438757-70443447 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70439519 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 378 (H378Q)

Ref Sequence

ENSEMBL: ENSMUSP00000137614 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000793] [ENSMUST00000180358]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000793
AA Change: H378Q

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000000793
Gene: ENSMUSG00000000776
AA Change: H378Q

Domain	Start	End	E-Value	Type
low complexity region	13	31	N/A	INTRINSIC
low complexity region	78	99	N/A	INTRINSIC
low complexity region	141	152	N/A	INTRINSIC
low complexity region	217	241	N/A	INTRINSIC
Pfam:RNA_pol_Rpc4	263	389	7.9e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083594

Predicted Effect

possibly damaging
Transcript: ENSMUST00000180358
AA Change: H378Q

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000137614
Gene: ENSMUSG00000000776
AA Change: H378Q

Domain	Start	End	E-Value	Type
low complexity region	13	31	N/A	INTRINSIC
low complexity region	78	99	N/A	INTRINSIC
low complexity region	141	152	N/A	INTRINSIC
low complexity region	217	241	N/A	INTRINSIC
Pfam:RNA_pol_Rpc4	262	389	3e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226549

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227748

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227985

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene complements a temperature-sensitive mutant isolated from the BHK-21 Syrian hamster cell line. It leads to a block in progression through the G1 phase of the cell cycle at nonpermissive temperatures. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,983,038	T181I	possibly damaging	Het
1810043G02Rik	A	T	10: 77,984,547	*250C	probably null	Het
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamts20	T	C	15: 94,291,713		probably benign	Het
Adamtsl1	T	C	4: 86,418,552	L1558S	probably damaging	Het
Ap3b2	A	G	7: 81,464,629		probably null	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
Brms1l	A	G	12: 55,861,388		probably null	Het
C8b	A	G	4: 104,793,380	I462V	probably benign	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Copa	T	C	1: 172,112,137	V624A	possibly damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Gtf2ird2	G	T	5: 134,211,242	E302*	probably null	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Ncapg2	T	A	12: 116,423,215	I286N	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Pitpnm2	A	G	5: 124,140,517		probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Ptpn13	T	C	5: 103,489,765	V173A	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Tprn	T	C	2: 25,264,321	V545A	probably damaging	Het
Trim66	T	C	7: 109,460,695	H828R	probably benign	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Vps9d1	A	G	8: 123,246,748	V432A	probably damaging	Het
Zswim9	A	T	7: 13,261,026	D401E	probably damaging	Het

Other mutations in Polr3d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02653:Polr3d	APN	14	70440117	missense	probably damaging	1.00
IGL03006:Polr3d	APN	14	70441163	critical splice acceptor site	probably null
PIT4449001:Polr3d	UTSW	14	70439463	missense	probably benign	0.27
R1435:Polr3d	UTSW	14	70440039	missense	probably benign	0.22
R1710:Polr3d	UTSW	14	70443010	missense	probably benign	0.03
R1714:Polr3d	UTSW	14	70441315	missense	possibly damaging	0.90
R1748:Polr3d	UTSW	14	70439475	nonsense	probably null
R2136:Polr3d	UTSW	14	70443047	frame shift	probably null
R5506:Polr3d	UTSW	14	70440759	missense	possibly damaging	0.69
R5984:Polr3d	UTSW	14	70439487	missense	possibly damaging	0.90
R6725:Polr3d	UTSW	14	70441137	missense	probably benign	0.00
R6880:Polr3d	UTSW	14	70440015	missense	probably benign	0.00
R7447:Polr3d	UTSW	14	70439800	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTGGGACTACAGCCAAAGGCTAC -3'
(R):5'- TGGGCAAGGTGACTCTAGATGTGAC -3'

Sequencing Primer
(F):5'- CCAAAGGCTACAACGGGTG -3'
(R):5'- ATGGGAACGACCTGTTCTTTC -3'

Posted On

2013-06-11