Incidental Mutation 'R0568:Polr3d'
ID 46275
Institutional Source Beutler Lab
Gene Symbol Polr3d
Ensembl Gene ENSMUSG00000000776
Gene Name polymerase (RNA) III (DNA directed) polypeptide D
Synonyms TSBN51, RPC4, 44kDa, 2810426M17Rik, BN51T
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock # R0568 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 70438757-70443447 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 70439519 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 378 (H378Q)
Ref Sequence ENSEMBL: ENSMUSP00000137614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000793] [ENSMUST00000180358]
AlphaFold Q91WD1
Predicted Effect possibly damaging
Transcript: ENSMUST00000000793
AA Change: H378Q

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000000793
Gene: ENSMUSG00000000776
AA Change: H378Q

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 78 99 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 217 241 N/A INTRINSIC
Pfam:RNA_pol_Rpc4 263 389 7.9e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083594
Predicted Effect possibly damaging
Transcript: ENSMUST00000180358
AA Change: H378Q

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137614
Gene: ENSMUSG00000000776
AA Change: H378Q

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 78 99 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 217 241 N/A INTRINSIC
Pfam:RNA_pol_Rpc4 262 389 3e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227985
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene complements a temperature-sensitive mutant isolated from the BHK-21 Syrian hamster cell line. It leads to a block in progression through the G1 phase of the cell cycle at nonpermissive temperatures. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in Polr3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02653:Polr3d APN 14 70440117 missense probably damaging 1.00
IGL03006:Polr3d APN 14 70441163 critical splice acceptor site probably null
G1patch:Polr3d UTSW 14 70441137 missense probably benign 0.00
PIT4449001:Polr3d UTSW 14 70439463 missense probably benign 0.27
R1435:Polr3d UTSW 14 70440039 missense probably benign 0.22
R1710:Polr3d UTSW 14 70443010 missense probably benign 0.03
R1714:Polr3d UTSW 14 70441315 missense possibly damaging 0.90
R1748:Polr3d UTSW 14 70439475 nonsense probably null
R2136:Polr3d UTSW 14 70443047 frame shift probably null
R5506:Polr3d UTSW 14 70440759 missense possibly damaging 0.69
R5984:Polr3d UTSW 14 70439487 missense possibly damaging 0.90
R6725:Polr3d UTSW 14 70441137 missense probably benign 0.00
R6880:Polr3d UTSW 14 70440015 missense probably benign 0.00
R7447:Polr3d UTSW 14 70439800 missense probably damaging 0.99
R9053:Polr3d UTSW 14 70440713 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGGACTACAGCCAAAGGCTAC -3'
(R):5'- TGGGCAAGGTGACTCTAGATGTGAC -3'

Sequencing Primer
(F):5'- CCAAAGGCTACAACGGGTG -3'
(R):5'- ATGGGAACGACCTGTTCTTTC -3'
Posted On 2013-06-11