Mutagenetix > Incidental Mutations

Incidental Mutation 'R0568:Adamts20'

46276

Institutional Source

Beutler Lab

Gene Symbol

Adamts20

Ensembl Gene

ENSMUSG00000022449

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20

Synonyms

ADAMTS-20, bt

MMRRC Submission

038759-MU

Accession Numbers

Genbank: NM_177431; MGI: 2660628

Is this an essential gene?

Probably non essential (E-score: 0.216) question?

Stock #

R0568 (G1)

Quality Score

139

Status

Validated

Chromosome

Chromosomal Location

94270163-94465418 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 94291713 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000036330 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035342]

Predicted Effect

probably benign
Transcript: ENSMUST00000035342

SMART Domains

Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	186	1.4e-30	PFAM
Pfam:Reprolysin_5	253	445	3.6e-13	PFAM
Pfam:Reprolysin_4	253	460	1.1e-7	PFAM
Pfam:Reprolysin	255	464	1.5e-26	PFAM
Pfam:Reprolysin_2	272	454	1.8e-10	PFAM
Pfam:Reprolysin_3	276	410	5.8e-10	PFAM
TSP1	556	608	7.73e-11	SMART
Pfam:ADAM_spacer1	718	836	2.6e-34	PFAM
TSP1	846	901	1.47e-1	SMART
TSP1	904	958	2.83e0	SMART
TSP1	965	1019	4.28e-4	SMART
TSP1	1020	1074	1.89e-5	SMART
TSP1	1075	1131	4.87e-8	SMART
TSP1	1152	1201	6.05e-4	SMART
TSP1	1204	1260	1.22e-8	SMART
TSP1	1304	1356	1.37e-2	SMART
TSP1	1357	1411	6e-8	SMART
TSP1	1416	1470	1.69e-2	SMART
TSP1	1471	1526	2.3e0	SMART
TSP1	1530	1579	1.23e0	SMART
TSP1	1653	1706	5.27e-4	SMART
Pfam:GON	1708	1905	5.8e-80	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]

Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,983,038	T181I	possibly damaging	Het
1810043G02Rik	A	T	10: 77,984,547	*250C	probably null	Het
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamtsl1	T	C	4: 86,418,552	L1558S	probably damaging	Het
Ap3b2	A	G	7: 81,464,629		probably null	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
Brms1l	A	G	12: 55,861,388		probably null	Het
C8b	A	G	4: 104,793,380	I462V	probably benign	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Copa	T	C	1: 172,112,137	V624A	possibly damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Gtf2ird2	G	T	5: 134,211,242	E302*	probably null	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Ncapg2	T	A	12: 116,423,215	I286N	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Pitpnm2	A	G	5: 124,140,517		probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Polr3d	A	T	14: 70,439,519	H378Q	possibly damaging	Het
Ptpn13	T	C	5: 103,489,765	V173A	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Tprn	T	C	2: 25,264,321	V545A	probably damaging	Het
Trim66	T	C	7: 109,460,695	H828R	probably benign	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Vps9d1	A	G	8: 123,246,748	V432A	probably damaging	Het
Zswim9	A	T	7: 13,261,026	D401E	probably damaging	Het

Other mutations in Adamts20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Adamts20	APN	15	94394641	missense	probably benign
IGL00491:Adamts20	APN	15	94273232	missense	possibly damaging	0.89
IGL00502:Adamts20	APN	15	94403397	missense	probably damaging	0.99
IGL00672:Adamts20	APN	15	94341105	missense	probably damaging	0.99
IGL00840:Adamts20	APN	15	94282482	missense	probably damaging	1.00
IGL00909:Adamts20	APN	15	94379813	missense	probably damaging	1.00
IGL01101:Adamts20	APN	15	94344042	missense	probably damaging	1.00
IGL01137:Adamts20	APN	15	94394611	critical splice donor site	probably null
IGL01457:Adamts20	APN	15	94331448	missense	probably damaging	0.97
IGL01685:Adamts20	APN	15	94403446	missense	possibly damaging	0.81
IGL01949:Adamts20	APN	15	94326106	missense	probably benign	0.08
IGL02525:Adamts20	APN	15	94283078	splice site	probably null
IGL03088:Adamts20	APN	15	94329914	critical splice donor site	probably null
IGL03175:Adamts20	APN	15	94273255	nonsense	probably null
belt	UTSW	15	94345990	missense	probably damaging	1.00
buckeye	UTSW	15	94341087	missense	probably damaging	1.00
jack_white	UTSW	15		unclassified
Meowth	UTSW	15	94331458	missense	probably damaging	1.00
nidoking	UTSW	15	94403445	missense	probably damaging	1.00
panda	UTSW	15	94326699	intron	probably benign
pikachu	UTSW	15	94345990	missense	probably damaging	1.00
poliwag	UTSW	15	94394622	nonsense	probably null
splotch2	UTSW	15	94335561	intron	probably benign
wash	UTSW	15	94347670	nonsense	probably null
whitebelly	UTSW	15		unclassified
whopper	UTSW	15	94347810	missense	probably damaging	1.00
R0483:Adamts20	UTSW	15	94353571	missense	probably benign	0.00
R0514:Adamts20	UTSW	15	94270376	missense	probably damaging	1.00
R0730:Adamts20	UTSW	15	94347690	missense	probably benign	0.00
R0973:Adamts20	UTSW	15	94286371	missense	probably benign	0.00
R1339:Adamts20	UTSW	15	94322896	missense	probably benign	0.19
R1721:Adamts20	UTSW	15	94338459	missense	probably benign	0.44
R1809:Adamts20	UTSW	15	94341087	missense	probably damaging	1.00
R1832:Adamts20	UTSW	15	94286344	missense	probably benign	0.00
R1846:Adamts20	UTSW	15	94345990	missense	probably damaging	1.00
R1867:Adamts20	UTSW	15	94338459	missense	probably benign	0.44
R1875:Adamts20	UTSW	15	94331396	missense	probably benign	0.01
R1930:Adamts20	UTSW	15	94404010	missense	probably benign	0.03
R1931:Adamts20	UTSW	15	94404010	missense	probably benign	0.03
R1932:Adamts20	UTSW	15	94404010	missense	probably benign	0.03
R2001:Adamts20	UTSW	15	94347718	missense	possibly damaging	0.96
R2116:Adamts20	UTSW	15	94355362	missense	probably damaging	1.00
R2162:Adamts20	UTSW	15	94331458	missense	probably damaging	1.00
R2350:Adamts20	UTSW	15	94283916	missense	probably damaging	1.00
R2887:Adamts20	UTSW	15	94330578	missense	probably benign	0.00
R2889:Adamts20	UTSW	15	94330578	missense	probably benign	0.00
R2890:Adamts20	UTSW	15	94330578	missense	probably benign	0.00
R3109:Adamts20	UTSW	15	94345904	splice site	probably benign
R3719:Adamts20	UTSW	15	94361838	missense	probably damaging	0.99
R3832:Adamts20	UTSW	15	94331458	missense	probably damaging	1.00
R3901:Adamts20	UTSW	15	94328845	missense	possibly damaging	0.81
R4398:Adamts20	UTSW	15	94333695	missense	possibly damaging	0.93
R4402:Adamts20	UTSW	15	94379946	missense	probably benign
R4431:Adamts20	UTSW	15	94344043	missense	probably damaging	1.00
R4479:Adamts20	UTSW	15	94403445	missense	probably damaging	1.00
R4482:Adamts20	UTSW	15	94345920	missense	probably damaging	1.00
R4503:Adamts20	UTSW	15	94379750	missense	probably damaging	0.99
R4671:Adamts20	UTSW	15	94403325	missense	possibly damaging	0.48
R4700:Adamts20	UTSW	15	94394622	nonsense	probably null
R4707:Adamts20	UTSW	15	94333647	missense	possibly damaging	0.53
R4725:Adamts20	UTSW	15	94351762	missense	probably damaging	0.99
R4771:Adamts20	UTSW	15	94351635	splice site	probably null
R4829:Adamts20	UTSW	15	94326396	missense	probably benign	0.01
R4937:Adamts20	UTSW	15	94379775	missense	probably benign
R4960:Adamts20	UTSW	15	94379774	missense	probably benign
R5270:Adamts20	UTSW	15	94282519	missense	probably benign	0.00
R5388:Adamts20	UTSW	15	94345778	missense	possibly damaging	0.81
R5410:Adamts20	UTSW	15	94281957	missense	possibly damaging	0.94
R5453:Adamts20	UTSW	15	94326088	missense	possibly damaging	0.69
R5611:Adamts20	UTSW	15	94273280	missense	possibly damaging	0.65
R5687:Adamts20	UTSW	15	94325971	missense	probably benign	0.36
R5758:Adamts20	UTSW	15	94394650	missense	probably benign	0.00
R5801:Adamts20	UTSW	15	94347670	nonsense	probably null
R5834:Adamts20	UTSW	15	94353584	missense	probably damaging	0.99
R5993:Adamts20	UTSW	15	94338723	missense	probably damaging	0.99
R5997:Adamts20	UTSW	15	94379747	missense	probably damaging	1.00
R6044:Adamts20	UTSW	15	94282483	missense	probably damaging	1.00
R6058:Adamts20	UTSW	15	94330047	nonsense	probably null
R6217:Adamts20	UTSW	15	94338715	missense	probably benign	0.00
R6283:Adamts20	UTSW	15	94351721	missense	probably benign
R6354:Adamts20	UTSW	15	94347810	missense	probably damaging	1.00
R6415:Adamts20	UTSW	15	94324659	critical splice donor site	probably null
R6419:Adamts20	UTSW	15	94333675	missense	possibly damaging	0.84
R6476:Adamts20	UTSW	15	94361810	missense	probably benign	0.22
R6485:Adamts20	UTSW	15	94343971	missense	probably benign	0.17
R6517:Adamts20	UTSW	15	94283104	intron	probably null
R6675:Adamts20	UTSW	15	94331316	critical splice donor site	probably null
R6863:Adamts20	UTSW	15	94379746	nonsense	probably null
R7186:Adamts20	UTSW	15	94322808	missense	possibly damaging	0.76
R7263:Adamts20	UTSW	15	94322891	missense	possibly damaging	0.52
R7441:Adamts20	UTSW	15	94353673	missense	probably damaging	1.00
R7519:Adamts20	UTSW	15	94325988	missense	possibly damaging	0.64
R7747:Adamts20	UTSW	15	94291587	nonsense	probably null
R7770:Adamts20	UTSW	15	94333698	missense	probably benign	0.02
R7816:Adamts20	UTSW	15	94322844	missense	probably benign	0.00
R7827:Adamts20	UTSW	15	94325933	missense	probably damaging	1.00
R7853:Adamts20	UTSW	15	94345990	missense	probably damaging	1.00
R7894:Adamts20	UTSW	15	94351760	missense	probably damaging	1.00
R7936:Adamts20	UTSW	15	94345990	missense	probably damaging	1.00
R7977:Adamts20	UTSW	15	94351760	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGGCCTTCCATGAAGGGCATC -3'
(R):5'- GCTCCACAGAGATATGCCTGACAC -3'

Sequencing Primer
(F):5'- ATCGTCCCGATCTGCAAG -3'
(R):5'- CTTACTATACTGAGTGACCATGAGG -3'

Posted On

2013-06-11