Incidental Mutation 'R0569:Phkb'
ID46305
Institutional Source Beutler Lab
Gene Symbol Phkb
Ensembl Gene ENSMUSG00000036879
Gene Namephosphorylase kinase beta
Synonyms
MMRRC Submission 038760-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R0569 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85840959-86061376 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86017402 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 560 (I560N)
Ref Sequence ENSEMBL: ENSMUSP00000050788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053771]
Predicted Effect probably damaging
Transcript: ENSMUST00000053771
AA Change: I560N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050788
Gene: ENSMUSG00000036879
AA Change: I560N

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 39 870 1.5e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160731
SMART Domains Protein: ENSMUSP00000125051
Gene: ENSMUSG00000036879

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 26 301 2.2e-23 PFAM
Meta Mutation Damage Score 0.9416 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, encoded by this gene, which is a member of the phosphorylase b kinase regulatory subunit family. The gamma subunit also includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9B, also known as phosphorylase kinase deficiency of liver and muscle. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. Two pseudogenes have been found on chromosomes 14 and 20, respectively.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,484,480 I572M possibly damaging Het
4930447A16Rik T C 15: 37,425,619 M1T probably null Het
4930590J08Rik C A 6: 91,942,578 C739* probably null Het
Adcy1 T A 11: 7,146,514 V634E probably benign Het
Ankfy1 T A 11: 72,753,608 H710Q possibly damaging Het
Ankrd60 C T 2: 173,571,066 V90M probably damaging Het
Asgr2 A T 11: 70,097,877 Q132L probably benign Het
Cchcr1 T A 17: 35,528,968 probably null Het
Ces1h T C 8: 93,352,146 K523E unknown Het
Clec3a G T 8: 114,425,736 G161C probably damaging Het
Cracr2b G A 7: 141,464,935 probably benign Het
Cyp2b10 A T 7: 25,897,735 L17F probably damaging Het
Dhx29 T A 13: 112,948,214 N655K probably benign Het
Dst C A 1: 34,293,427 L4748I probably damaging Het
Eif2b5 G C 16: 20,502,553 L285F probably benign Het
Enox1 T A 14: 77,637,677 D441E probably damaging Het
Fam110a T C 2: 151,970,484 E122G probably damaging Het
Fam161b T A 12: 84,348,639 E510V probably damaging Het
Gabrd T C 4: 155,385,423 Y443C probably damaging Het
Gcn1l1 T G 5: 115,595,059 S1052A probably benign Het
Gnptab A G 10: 88,428,557 E279G possibly damaging Het
Hoxa6 T A 6: 52,208,183 probably null Het
Ibtk T A 9: 85,708,181 probably benign Het
Il6ra A T 3: 89,877,842 probably null Het
Iqgap3 C T 3: 88,090,725 probably benign Het
Kcnk2 A C 1: 189,339,801 L110R probably damaging Het
Knl1 T A 2: 119,097,435 V1919D possibly damaging Het
Lrp1b A T 2: 40,889,239 L2597Q probably benign Het
Magi3 A G 3: 104,016,042 S1120P probably benign Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcat C T 15: 83,549,248 R198H probably benign Het
Mnd1 A G 3: 84,104,979 V141A probably benign Het
Morc1 T C 16: 48,587,122 L667P probably benign Het
Mrps6 A G 16: 92,111,920 K125E possibly damaging Het
Mst1 T C 9: 108,082,301 F262S probably damaging Het
Olfr1052 T G 2: 86,298,597 I260M probably damaging Het
Olfr18 T A 9: 20,314,579 I114F probably damaging Het
Pbsn C G X: 77,853,440 G15A possibly damaging Het
Pcnx T C 12: 81,992,030 I2023T probably benign Het
Pds5a T G 5: 65,656,401 N247T probably damaging Het
Peak1 T C 9: 56,260,089 Y185C probably damaging Het
Plekhn1 T C 4: 156,225,201 I160V probably damaging Het
Rabgap1 T G 2: 37,489,717 probably benign Het
Rdh10 T G 1: 16,129,293 V241G probably damaging Het
Selenow A T 7: 15,920,117 C37S probably benign Het
Sema6a A T 18: 47,270,805 probably null Het
Slc12a3 T C 8: 94,330,525 probably null Het
Slc22a21 T G 11: 53,951,810 M498L probably benign Het
Spink5 A T 18: 43,989,419 N317I probably damaging Het
Srek1 A G 13: 103,748,862 probably benign Het
Syt11 A G 3: 88,747,923 V357A probably benign Het
Tcof1 T A 18: 60,829,035 K707N possibly damaging Het
Tfip11 C T 5: 112,328,094 R42C probably damaging Het
Trim39 T C 17: 36,263,731 K260E probably benign Het
Ttn T C 2: 76,723,319 T22658A possibly damaging Het
Unc45b C T 11: 82,936,812 probably benign Het
Vmn1r236 A G 17: 21,286,910 I97V probably benign Het
Vps13c T C 9: 67,973,719 V657A probably damaging Het
Zkscan2 A G 7: 123,498,675 V166A probably benign Het
Other mutations in Phkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Phkb APN 8 85957587 missense probably benign 0.42
IGL01126:Phkb APN 8 85946101 missense probably benign 0.12
IGL01700:Phkb APN 8 86017465 missense probably benign 0.06
IGL01761:Phkb APN 8 86019064 missense probably benign 0.01
IGL02404:Phkb APN 8 85878115 missense possibly damaging 0.94
IGL02672:Phkb APN 8 85942358 missense probably benign
IGL02682:Phkb APN 8 85875646 makesense probably null
IGL02693:Phkb APN 8 85942234 missense probably damaging 1.00
IGL02798:Phkb APN 8 86043777 missense probably benign
IGL02888:Phkb APN 8 85935472 critical splice donor site probably null
IGL03106:Phkb APN 8 86018466 splice site probably benign
PIT4544001:Phkb UTSW 8 86011637 missense probably benign 0.42
R0088:Phkb UTSW 8 85942391 critical splice donor site probably null
R0107:Phkb UTSW 8 86016931 missense probably benign 0.01
R0504:Phkb UTSW 8 86056524 missense probably benign
R0671:Phkb UTSW 8 85875693 missense probably damaging 0.97
R0894:Phkb UTSW 8 86017441 missense probably damaging 1.00
R1491:Phkb UTSW 8 85875657 missense possibly damaging 0.90
R1502:Phkb UTSW 8 86059339 missense possibly damaging 0.69
R1595:Phkb UTSW 8 86026553 splice site probably benign
R1686:Phkb UTSW 8 86021649 missense probably benign
R1913:Phkb UTSW 8 85901920 missense possibly damaging 0.95
R1919:Phkb UTSW 8 85922161 missense probably benign 0.17
R1968:Phkb UTSW 8 85970951 missense probably benign 0.07
R2008:Phkb UTSW 8 86056467 missense probably damaging 1.00
R2051:Phkb UTSW 8 86049821 critical splice donor site probably null
R2148:Phkb UTSW 8 86017486 missense probably damaging 0.96
R2305:Phkb UTSW 8 86043802 missense possibly damaging 0.80
R3801:Phkb UTSW 8 85922229 nonsense probably null
R3804:Phkb UTSW 8 85922229 nonsense probably null
R4159:Phkb UTSW 8 86021533 splice site probably null
R4624:Phkb UTSW 8 85848712 intron probably benign
R4833:Phkb UTSW 8 85901911 missense probably damaging 1.00
R5017:Phkb UTSW 8 86049809 missense probably benign
R5169:Phkb UTSW 8 85896491 missense probably benign 0.01
R5337:Phkb UTSW 8 85878245 missense probably damaging 1.00
R5391:Phkb UTSW 8 86017468 missense probably damaging 1.00
R5395:Phkb UTSW 8 86017468 missense probably damaging 1.00
R5480:Phkb UTSW 8 85922182 missense probably damaging 1.00
R5538:Phkb UTSW 8 85922127 missense possibly damaging 0.80
R5623:Phkb UTSW 8 85843048 unclassified probably benign
R5753:Phkb UTSW 8 85878230 missense probably damaging 1.00
R5909:Phkb UTSW 8 86021447 critical splice donor site probably null
R5929:Phkb UTSW 8 85970914 missense probably benign 0.01
R6093:Phkb UTSW 8 85942329 missense probably damaging 1.00
R6320:Phkb UTSW 8 85875698 missense probably benign 0.00
R6324:Phkb UTSW 8 86018542 missense probably benign 0.00
R6626:Phkb UTSW 8 85922151 missense probably damaging 0.96
R6687:Phkb UTSW 8 86029546 missense probably damaging 1.00
R6848:Phkb UTSW 8 86029617 missense probably damaging 0.99
R7228:Phkb UTSW 8 85843007 unclassified probably benign
R7260:Phkb UTSW 8 85878130 missense probably benign 0.07
R7271:Phkb UTSW 8 86043789 missense probably damaging 1.00
R7314:Phkb UTSW 8 85942392 splice site probably null
R7586:Phkb UTSW 8 86029597 missense probably damaging 1.00
R7654:Phkb UTSW 8 85940887 missense possibly damaging 0.91
X0021:Phkb UTSW 8 86029635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCCTTGGTACATCAAAGGTGAG -3'
(R):5'- GTGTAACCTAGCATCATGGACACCC -3'

Sequencing Primer
(F):5'- CATGCAGAATCATGCTTGGC -3'
(R):5'- TGGACACCCAGGAATCCTC -3'
Posted On2013-06-11