Incidental Mutation 'R0570:Stk39'
ID46347
Institutional Source Beutler Lab
Gene Symbol Stk39
Ensembl Gene ENSMUSG00000027030
Gene Nameserine/threonine kinase 39
SynonymsDCHT, Rnl5, RF005, SPAK
MMRRC Submission 038761-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.433) question?
Stock #R0570 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location68210445-68472268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 68410048 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 113 (T113M)
Ref Sequence ENSEMBL: ENSMUSP00000099776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102715]
Predicted Effect probably damaging
Transcript: ENSMUST00000102715
AA Change: T113M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099776
Gene: ENSMUSG00000027030
AA Change: T113M

DomainStartEndE-ValueType
low complexity region 14 65 N/A INTRINSIC
S_TKc 75 349 4.44e-80 SMART
Pfam:OSR1_C 463 494 1.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123781
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase that is thought to function in the cellular stress response pathway. The kinase is activated in response to hypotonic stress, leading to phosphorylation of several cation-chloride-coupled cotransporters. The catalytically active kinase specifically activates the p38 MAP kinase pathway, and its interaction with p38 decreases upon cellular stress, suggesting that this kinase may serve as an intermediate in the response to cellular stress. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced bumetanide-sensitive thallium, a potassium tracer, uptake in dorsal root ganglion neurons and reduced fertility. Mice with an ENU mutation in intron 8 exhibit elevated albumin-creatinine (ACR) ratios. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik C A 8: 84,003,104 probably benign Het
Aadacl3 C T 4: 144,463,560 W57* probably null Het
Abca2 G T 2: 25,447,405 probably null Het
Abca3 A G 17: 24,374,399 I257V probably benign Het
Adamts2 A G 11: 50,776,136 D420G probably damaging Het
Adamts5 A G 16: 85,899,247 F341L probably damaging Het
Ahnak T A 19: 9,013,698 D4115E probably damaging Het
Arhgap20 T C 9: 51,840,451 S365P possibly damaging Het
Atrn G A 2: 130,980,134 V916I probably benign Het
Blmh T C 11: 76,965,825 V82A probably damaging Het
C1ra A T 6: 124,513,705 Y19F probably benign Het
Cactin A G 10: 81,323,233 E306G probably damaging Het
Celsr1 C T 15: 85,903,365 R2724Q probably benign Het
Clca4b T C 3: 144,925,349 E250G probably benign Het
Col17a1 A T 19: 47,665,878 S647T possibly damaging Het
Cope T A 8: 70,306,531 D74E probably damaging Het
Dsg1c T C 18: 20,270,378 I198T probably damaging Het
Elfn2 T C 15: 78,673,234 N371S probably damaging Het
Elmo2 G T 2: 165,304,919 A246D probably benign Het
Ewsr1 A T 11: 5,085,935 M187K possibly damaging Het
Faap100 A T 11: 120,374,288 S587R possibly damaging Het
Fam234b C T 6: 135,209,249 S85L probably benign Het
Fanca A T 8: 123,306,430 S292R probably benign Het
Fanci G A 7: 79,443,963 C1021Y probably damaging Het
Fhod3 T C 18: 25,112,583 I1230T probably benign Het
Fmo5 T C 3: 97,629,140 L27S probably damaging Het
Fmo9 A G 1: 166,674,462 V147A probably null Het
Fnbp4 A G 2: 90,752,957 Y309C probably damaging Het
Foxb1 T C 9: 69,759,562 T229A probably benign Het
Gapvd1 A G 2: 34,728,540 Y274H probably damaging Het
Gbp8 T C 5: 105,017,675 probably null Het
Gcn1l1 T A 5: 115,592,421 L888Q probably damaging Het
Gm17490 T C 2: 11,625,649 probably benign Het
Gtf2ird2 T A 5: 134,208,944 probably null Het
H2-Q1 A G 17: 35,321,397 T153A possibly damaging Het
Ina A C 19: 47,023,499 E452A probably benign Het
Kars A G 8: 111,994,862 probably null Het
Kif1c A G 11: 70,704,465 E124G probably damaging Het
Lpin3 T C 2: 160,904,024 probably benign Het
Lrp1 A T 10: 127,555,009 C3006* probably null Het
Lyst T C 13: 13,709,386 L2953P probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Melk T C 4: 44,308,906 Y88H probably damaging Het
Myrf A G 19: 10,211,797 S857P probably damaging Het
Nos2 A G 11: 78,935,361 I153M possibly damaging Het
Olfr732 T G 14: 50,281,913 L113F probably benign Het
Otof A G 5: 30,371,881 probably benign Het
Patl2 A G 2: 122,125,308 V249A probably damaging Het
Pcgf5 A G 19: 36,412,180 Y19C probably benign Het
Pcnt A T 10: 76,412,107 V951E probably damaging Het
Pcolce2 T C 9: 95,638,657 V29A probably benign Het
Pdgfrb A T 18: 61,077,703 M761L probably benign Het
Pi16 A T 17: 29,319,215 M1L possibly damaging Het
Pkd2 T A 5: 104,455,605 probably benign Het
Plcb2 A G 2: 118,717,325 W474R probably benign Het
Psapl1 A G 5: 36,204,280 D72G possibly damaging Het
Ptpn5 T A 7: 47,078,933 probably benign Het
Ptprg A G 14: 12,215,896 E1115G probably damaging Het
Rassf1 C T 9: 107,557,966 T224I probably damaging Het
Rbpms2 T A 9: 65,659,194 C168* probably null Het
Rhag A G 17: 40,828,913 probably benign Het
Rhebl1 C T 15: 98,881,153 V17I probably benign Het
Rnf130 A T 11: 50,095,876 D349V possibly damaging Het
Rprd1a A G 18: 24,509,895 L60P probably damaging Het
Rspry1 T C 8: 94,629,792 I25T probably damaging Het
Ruvbl2 C T 7: 45,422,197 V421M probably damaging Het
Sap30 T C 8: 57,482,966 N209D possibly damaging Het
Sfswap T C 5: 129,503,978 probably benign Het
Slc1a2 G A 2: 102,756,007 V319M probably damaging Het
Smad2 T C 18: 76,289,179 probably benign Het
Spdya T C 17: 71,562,590 probably null Het
Tanc1 A G 2: 59,796,038 probably benign Het
Tas2r122 T C 6: 132,711,811 K40E probably damaging Het
Tph2 G T 10: 115,174,134 probably benign Het
Trip12 G A 1: 84,751,548 S1083F probably damaging Het
Tsc2 A T 17: 24,626,727 C206S probably damaging Het
Tsc22d4 A G 5: 137,762,419 Q34R possibly damaging Het
Uroc1 G T 6: 90,338,564 M142I possibly damaging Het
Uso1 T C 5: 92,199,823 S766P probably benign Het
Usp21 G A 1: 171,283,746 probably benign Het
Usp48 T A 4: 137,633,126 I658K possibly damaging Het
Vmn1r206 T C 13: 22,620,413 H208R probably damaging Het
Vmn2r109 C T 17: 20,540,675 A807T probably damaging Het
Zfp329 A T 7: 12,810,452 C382S probably damaging Het
Zfp341 A G 2: 154,646,068 E817G probably benign Het
Other mutations in Stk39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Stk39 APN 2 68314564 missense possibly damaging 0.81
IGL00966:Stk39 APN 2 68211958 missense probably benign 0.01
IGL01936:Stk39 APN 2 68314564 missense probably benign 0.21
IGL02301:Stk39 APN 2 68211962 missense probably damaging 1.00
IGL02940:Stk39 APN 2 68220899 splice site probably null
claimjumper UTSW 2 68314579 missense probably damaging 0.96
outlaw UTSW 2 68307039 critical splice donor site probably null
rustler UTSW 2 68263303 missense probably damaging 1.00
R0609:Stk39 UTSW 2 68366167 missense probably damaging 1.00
R0670:Stk39 UTSW 2 68366182 missense possibly damaging 0.93
R0980:Stk39 UTSW 2 68392171 missense probably damaging 1.00
R1024:Stk39 UTSW 2 68410046 missense probably damaging 1.00
R1573:Stk39 UTSW 2 68390949 missense probably damaging 1.00
R1713:Stk39 UTSW 2 68307116 splice site probably benign
R2223:Stk39 UTSW 2 68314579 missense probably damaging 0.96
R3700:Stk39 UTSW 2 68392118 missense probably damaging 1.00
R4207:Stk39 UTSW 2 68220920 missense probably benign 0.42
R4298:Stk39 UTSW 2 68390940 missense probably damaging 1.00
R4726:Stk39 UTSW 2 68263303 missense probably damaging 1.00
R4975:Stk39 UTSW 2 68220992 intron probably benign
R5057:Stk39 UTSW 2 68220948 missense probably damaging 0.99
R5384:Stk39 UTSW 2 68410039 missense probably damaging 1.00
R5921:Stk39 UTSW 2 68366105 missense probably damaging 0.97
R6125:Stk39 UTSW 2 68392124 missense probably damaging 1.00
R6251:Stk39 UTSW 2 68307039 critical splice donor site probably null
R6332:Stk39 UTSW 2 68410043 missense possibly damaging 0.93
R6375:Stk39 UTSW 2 68392238 missense probably benign 0.34
R7057:Stk39 UTSW 2 68410127 missense possibly damaging 0.88
R7064:Stk39 UTSW 2 68358812 critical splice donor site probably null
R7691:Stk39 UTSW 2 68471639 missense probably damaging 0.97
R7921:Stk39 UTSW 2 68307039 critical splice donor site probably null
R8155:Stk39 UTSW 2 68267066 missense probably damaging 1.00
Z1176:Stk39 UTSW 2 68392198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACACTGAGACCACTGGAACTG -3'
(R):5'- ACCCAAGGGCTATCACCATTTCAAG -3'

Sequencing Primer
(F):5'- GCGCAGACCCAACACTG -3'
(R):5'- CAAGCAGAGTTGTACTCATCCTG -3'
Posted On2013-06-11