Mutagenetix > Incidental Mutations

Incidental Mutation 'R0570:Usp48'

46360

Institutional Source

Beutler Lab

Gene Symbol

Usp48

Ensembl Gene

ENSMUSG00000043411

Gene Name

ubiquitin specific peptidase 48

Synonyms

Usp31, D330022K21Rik, 2810449C13Rik

MMRRC Submission

038761-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R0570 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

137593755-137658537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 137633126 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 658 (I658K)

Ref Sequence

ENSEMBL: ENSMUSP00000055016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055131] [ENSMUST00000105840] [ENSMUST00000141628]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055131
AA Change: I658K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000055016
Gene: ENSMUSG00000043411
AA Change: I658K

Domain	Start	End	E-Value	Type
Pfam:UCH	88	417	6.9e-44	PFAM
Pfam:UCH_1	89	374	1e-22	PFAM
Blast:DUSP	479	555	5e-39	BLAST
coiled coil region	622	643	N/A	INTRINSIC
UBQ	954	1022	4.78e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105840
AA Change: I660K

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000101466
Gene: ENSMUSG00000043411
AA Change: I660K

Domain	Start	End	E-Value	Type
Pfam:UCH	88	418	6.4e-49	PFAM
Pfam:UCH_1	89	374	1.8e-27	PFAM
Blast:DUSP	480	556	4e-39	BLAST
coiled coil region	624	645	N/A	INTRINSIC
Blast:DUSP	743	824	2e-7	BLAST
UBQ	938	1006	4.78e-1	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000128065
AA Change: I77K

SMART Domains

Protein: ENSMUSP00000115533
Gene: ENSMUSG00000043411
AA Change: I77K

Domain	Start	End	E-Value	Type
Blast:DUSP	9	111	2e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000131755

Predicted Effect

probably benign
Transcript: ENSMUST00000141426

SMART Domains

Protein: ENSMUSP00000118084
Gene: ENSMUSG00000043411

Domain	Start	End	E-Value	Type
UBQ	63	131	4.78e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000141628

SMART Domains

Protein: ENSMUSP00000119691
Gene: ENSMUSG00000043411

Domain	Start	End	E-Value	Type
low complexity region	3	22	N/A	INTRINSIC
UBQ	185	253	4.78e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152985

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154395

Meta Mutation Damage Score

0.2328

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 97.0%
20x: 94.3%

Validation Efficiency

100% (85/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing domains that associate it with the peptidase family C19, also known as family 2 of ubiquitin carboxyl-terminal hydrolases. Family members function as deubiquitinating enzymes, recognizing and hydrolyzing the peptide bond at the C-terminal glycine of ubiquitin. Enzymes in peptidase family C19 are involved in the processing of poly-ubiquitin precursors as well as that of ubiquitinated proteins. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700067K01Rik	C	A	8: 84,003,104		probably benign	Het
Aadacl3	C	T	4: 144,463,560	W57*	probably null	Het
Abca2	G	T	2: 25,447,405		probably null	Het
Abca3	A	G	17: 24,374,399	I257V	probably benign	Het
Adamts2	A	G	11: 50,776,136	D420G	probably damaging	Het
Adamts5	A	G	16: 85,899,247	F341L	probably damaging	Het
Ahnak	T	A	19: 9,013,698	D4115E	probably damaging	Het
Arhgap20	T	C	9: 51,840,451	S365P	possibly damaging	Het
Atrn	G	A	2: 130,980,134	V916I	probably benign	Het
Blmh	T	C	11: 76,965,825	V82A	probably damaging	Het
C1ra	A	T	6: 124,513,705	Y19F	probably benign	Het
Cactin	A	G	10: 81,323,233	E306G	probably damaging	Het
Celsr1	C	T	15: 85,903,365	R2724Q	probably benign	Het
Clca4b	T	C	3: 144,925,349	E250G	probably benign	Het
Col17a1	A	T	19: 47,665,878	S647T	possibly damaging	Het
Cope	T	A	8: 70,306,531	D74E	probably damaging	Het
Dsg1c	T	C	18: 20,270,378	I198T	probably damaging	Het
Elfn2	T	C	15: 78,673,234	N371S	probably damaging	Het
Elmo2	G	T	2: 165,304,919	A246D	probably benign	Het
Ewsr1	A	T	11: 5,085,935	M187K	possibly damaging	Het
Faap100	A	T	11: 120,374,288	S587R	possibly damaging	Het
Fam234b	C	T	6: 135,209,249	S85L	probably benign	Het
Fanca	A	T	8: 123,306,430	S292R	probably benign	Het
Fanci	G	A	7: 79,443,963	C1021Y	probably damaging	Het
Fhod3	T	C	18: 25,112,583	I1230T	probably benign	Het
Fmo5	T	C	3: 97,629,140	L27S	probably damaging	Het
Fmo9	A	G	1: 166,674,462	V147A	probably null	Het
Fnbp4	A	G	2: 90,752,957	Y309C	probably damaging	Het
Foxb1	T	C	9: 69,759,562	T229A	probably benign	Het
Gapvd1	A	G	2: 34,728,540	Y274H	probably damaging	Het
Gbp8	T	C	5: 105,017,675		probably null	Het
Gcn1l1	T	A	5: 115,592,421	L888Q	probably damaging	Het
Gm17490	T	C	2: 11,625,649		probably benign	Het
Gtf2ird2	T	A	5: 134,208,944		probably null	Het
H2-Q1	A	G	17: 35,321,397	T153A	possibly damaging	Het
Ina	A	C	19: 47,023,499	E452A	probably benign	Het
Kars	A	G	8: 111,994,862		probably null	Het
Kif1c	A	G	11: 70,704,465	E124G	probably damaging	Het
Lpin3	T	C	2: 160,904,024		probably benign	Het
Lrp1	A	T	10: 127,555,009	C3006*	probably null	Het
Lyst	T	C	13: 13,709,386	L2953P	probably benign	Het
Mb21d2	G	A	16: 28,929,572	A31V	probably benign	Het
Melk	T	C	4: 44,308,906	Y88H	probably damaging	Het
Myrf	A	G	19: 10,211,797	S857P	probably damaging	Het
Nos2	A	G	11: 78,935,361	I153M	possibly damaging	Het
Olfr732	T	G	14: 50,281,913	L113F	probably benign	Het
Otof	A	G	5: 30,371,881		probably benign	Het
Patl2	A	G	2: 122,125,308	V249A	probably damaging	Het
Pcgf5	A	G	19: 36,412,180	Y19C	probably benign	Het
Pcnt	A	T	10: 76,412,107	V951E	probably damaging	Het
Pcolce2	T	C	9: 95,638,657	V29A	probably benign	Het
Pdgfrb	A	T	18: 61,077,703	M761L	probably benign	Het
Pi16	A	T	17: 29,319,215	M1L	possibly damaging	Het
Pkd2	T	A	5: 104,455,605		probably benign	Het
Plcb2	A	G	2: 118,717,325	W474R	probably benign	Het
Psapl1	A	G	5: 36,204,280	D72G	possibly damaging	Het
Ptpn5	T	A	7: 47,078,933		probably benign	Het
Ptprg	A	G	14: 12,215,896	E1115G	probably damaging	Het
Rassf1	C	T	9: 107,557,966	T224I	probably damaging	Het
Rbpms2	T	A	9: 65,659,194	C168*	probably null	Het
Rhag	A	G	17: 40,828,913		probably benign	Het
Rhebl1	C	T	15: 98,881,153	V17I	probably benign	Het
Rnf130	A	T	11: 50,095,876	D349V	possibly damaging	Het
Rprd1a	A	G	18: 24,509,895	L60P	probably damaging	Het
Rspry1	T	C	8: 94,629,792	I25T	probably damaging	Het
Ruvbl2	C	T	7: 45,422,197	V421M	probably damaging	Het
Sap30	T	C	8: 57,482,966	N209D	possibly damaging	Het
Sfswap	T	C	5: 129,503,978		probably benign	Het
Slc1a2	G	A	2: 102,756,007	V319M	probably damaging	Het
Smad2	T	C	18: 76,289,179		probably benign	Het
Spdya	T	C	17: 71,562,590		probably null	Het
Stk39	G	A	2: 68,410,048	T113M	probably damaging	Het
Tanc1	A	G	2: 59,796,038		probably benign	Het
Tas2r122	T	C	6: 132,711,811	K40E	probably damaging	Het
Tph2	G	T	10: 115,174,134		probably benign	Het
Trip12	G	A	1: 84,751,548	S1083F	probably damaging	Het
Tsc2	A	T	17: 24,626,727	C206S	probably damaging	Het
Tsc22d4	A	G	5: 137,762,419	Q34R	possibly damaging	Het
Uroc1	G	T	6: 90,338,564	M142I	possibly damaging	Het
Uso1	T	C	5: 92,199,823	S766P	probably benign	Het
Usp21	G	A	1: 171,283,746		probably benign	Het
Vmn1r206	T	C	13: 22,620,413	H208R	probably damaging	Het
Vmn2r109	C	T	17: 20,540,675	A807T	probably damaging	Het
Zfp329	A	T	7: 12,810,452	C382S	probably damaging	Het
Zfp341	A	G	2: 154,646,068	E817G	probably benign	Het

Other mutations in Usp48

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01691:Usp48	APN	4	137623272	critical splice acceptor site	probably null
IGL01864:Usp48	APN	4	137639227	missense	possibly damaging	0.87
IGL02386:Usp48	APN	4	137604523	missense	possibly damaging	0.93
IGL03112:Usp48	APN	4	137608064	missense	probably damaging	1.00
IGL03114:Usp48	APN	4	137656125	missense	probably damaging	1.00
IGL03406:Usp48	APN	4	137639295	missense	possibly damaging	0.90
balfour	UTSW	4	137633455	missense	probably benign	0.00
burlap	UTSW	4	137625276	missense	possibly damaging	0.77
fulfillment	UTSW	4	137638233	missense	probably damaging	1.00
hayao	UTSW	4	137633439	nonsense	probably null
Mei	UTSW	4	137606693	nonsense	probably null
miyazaki	UTSW	4	137608154	missense	probably damaging	1.00
promise	UTSW	4	137634921	missense	probably damaging	1.00
satsuki	UTSW	4	137633126	missense	possibly damaging	0.93
Totoro	UTSW	4	137594483	missense	probably damaging	0.99
IGL02796:Usp48	UTSW	4	137610718	missense	probably damaging	1.00
R0050:Usp48	UTSW	4	137613803	missense	probably damaging	1.00
R0333:Usp48	UTSW	4	137594483	missense	probably damaging	0.99
R0382:Usp48	UTSW	4	137621218	missense	probably benign	0.00
R0423:Usp48	UTSW	4	137616411	missense	probably benign
R0855:Usp48	UTSW	4	137608154	missense	probably damaging	1.00
R0943:Usp48	UTSW	4	137644470	missense	possibly damaging	0.92
R1367:Usp48	UTSW	4	137639295	missense	possibly damaging	0.90
R1367:Usp48	UTSW	4	137644463	missense	probably damaging	1.00
R1689:Usp48	UTSW	4	137656107	splice site	probably null
R1725:Usp48	UTSW	4	137633422	nonsense	probably null
R2520:Usp48	UTSW	4	137625251	missense	probably benign	0.05
R2965:Usp48	UTSW	4	137613762	missense	probably damaging	1.00
R2966:Usp48	UTSW	4	137613762	missense	probably damaging	1.00
R3026:Usp48	UTSW	4	137594444	missense	probably benign	0.06
R3963:Usp48	UTSW	4	137633439	nonsense	probably null
R4087:Usp48	UTSW	4	137623340	missense	possibly damaging	0.95
R4633:Usp48	UTSW	4	137634900	missense	probably damaging	0.96
R4677:Usp48	UTSW	4	137616381	missense	probably benign	0.16
R4735:Usp48	UTSW	4	137633369	nonsense	probably null
R4932:Usp48	UTSW	4	137615833	missense	probably benign	0.00
R4932:Usp48	UTSW	4	137615834	splice site	probably null
R4935:Usp48	UTSW	4	137650358	missense	probably benign	0.42
R4952:Usp48	UTSW	4	137606693	nonsense	probably null
R5034:Usp48	UTSW	4	137606757	nonsense	probably null
R5153:Usp48	UTSW	4	137616362	missense	possibly damaging	0.68
R5443:Usp48	UTSW	4	137621221	missense	possibly damaging	0.78
R5591:Usp48	UTSW	4	137652652	intron	probably benign
R5825:Usp48	UTSW	4	137623378	missense	probably benign
R5889:Usp48	UTSW	4	137616412	missense	probably benign
R5955:Usp48	UTSW	4	137615818	missense	probably benign
R6089:Usp48	UTSW	4	137605818	missense	probably damaging	1.00
R6443:Usp48	UTSW	4	137613763	missense	probably damaging	1.00
R6473:Usp48	UTSW	4	137609108	critical splice donor site	probably null
R6482:Usp48	UTSW	4	137634921	missense	probably damaging	1.00
R6859:Usp48	UTSW	4	137625276	missense	possibly damaging	0.77
R6916:Usp48	UTSW	4	137638233	missense	probably damaging	1.00
R6977:Usp48	UTSW	4	137650360	missense	probably damaging	1.00
R7749:Usp48	UTSW	4	137650417	missense	probably damaging	1.00
R7759:Usp48	UTSW	4	137594452	missense	probably benign	0.25
R7767:Usp48	UTSW	4	137604645	critical splice donor site	probably null
R7850:Usp48	UTSW	4	137605749	splice site	probably null
R7881:Usp48	UTSW	4	137633455	missense	probably benign	0.00
R7897:Usp48	UTSW	4	137644428	missense	probably damaging	0.96
R8186:Usp48	UTSW	4	137621196	missense	possibly damaging	0.83
R8198:Usp48	UTSW	4	137621159	unclassified	probably benign
R8353:Usp48	UTSW	4	137623382	missense	probably benign	0.00
R8466:Usp48	UTSW	4	137623319	missense	probably null	1.00
R8506:Usp48	UTSW	4	137610718	missense	probably damaging	1.00
RF002:Usp48	UTSW	4	137605795	missense	probably damaging	1.00
Z1176:Usp48	UTSW	4	137604637	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TAGGGTGGGTGGAACCTAACTACG -3'
(R):5'- GGCCAGTTACTGAGACATGGTCTG -3'

Sequencing Primer
(F):5'- gatgtagcctcagccacc -3'
(R):5'- GCTATCATCTTATGCAAGGCTTCG -3'

Posted On

2013-06-11