Incidental Mutation 'R0570:Rspry1'
ID46382
Institutional Source Beutler Lab
Gene Symbol Rspry1
Ensembl Gene ENSMUSG00000050079
Gene Namering finger and SPRY domain containing 1
Synonyms4930470D19Rik
MMRRC Submission 038761-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R0570 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location94601937-94660275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94629792 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 25 (I25T)
Ref Sequence ENSEMBL: ENSMUSP00000148724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000121101] [ENSMUST00000211983] [ENSMUST00000212729]
Predicted Effect probably damaging
Transcript: ENSMUST00000060389
AA Change: I149T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079
AA Change: I149T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
SPRY 358 482 2.94e-26 SMART
RING 527 561 3.93e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121101
SMART Domains Protein: ENSMUSP00000112482
Gene: ENSMUSG00000050079

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154035
Predicted Effect probably damaging
Transcript: ENSMUST00000211983
AA Change: I149T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000212729
AA Change: I25T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.5731 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik C A 8: 84,003,104 probably benign Het
Aadacl3 C T 4: 144,463,560 W57* probably null Het
Abca2 G T 2: 25,447,405 probably null Het
Abca3 A G 17: 24,374,399 I257V probably benign Het
Adamts2 A G 11: 50,776,136 D420G probably damaging Het
Adamts5 A G 16: 85,899,247 F341L probably damaging Het
Ahnak T A 19: 9,013,698 D4115E probably damaging Het
Arhgap20 T C 9: 51,840,451 S365P possibly damaging Het
Atrn G A 2: 130,980,134 V916I probably benign Het
Blmh T C 11: 76,965,825 V82A probably damaging Het
C1ra A T 6: 124,513,705 Y19F probably benign Het
Cactin A G 10: 81,323,233 E306G probably damaging Het
Celsr1 C T 15: 85,903,365 R2724Q probably benign Het
Clca4b T C 3: 144,925,349 E250G probably benign Het
Col17a1 A T 19: 47,665,878 S647T possibly damaging Het
Cope T A 8: 70,306,531 D74E probably damaging Het
Dsg1c T C 18: 20,270,378 I198T probably damaging Het
Elfn2 T C 15: 78,673,234 N371S probably damaging Het
Elmo2 G T 2: 165,304,919 A246D probably benign Het
Ewsr1 A T 11: 5,085,935 M187K possibly damaging Het
Faap100 A T 11: 120,374,288 S587R possibly damaging Het
Fam234b C T 6: 135,209,249 S85L probably benign Het
Fanca A T 8: 123,306,430 S292R probably benign Het
Fanci G A 7: 79,443,963 C1021Y probably damaging Het
Fhod3 T C 18: 25,112,583 I1230T probably benign Het
Fmo5 T C 3: 97,629,140 L27S probably damaging Het
Fmo9 A G 1: 166,674,462 V147A probably null Het
Fnbp4 A G 2: 90,752,957 Y309C probably damaging Het
Foxb1 T C 9: 69,759,562 T229A probably benign Het
Gapvd1 A G 2: 34,728,540 Y274H probably damaging Het
Gbp8 T C 5: 105,017,675 probably null Het
Gcn1l1 T A 5: 115,592,421 L888Q probably damaging Het
Gm17490 T C 2: 11,625,649 probably benign Het
Gtf2ird2 T A 5: 134,208,944 probably null Het
H2-Q1 A G 17: 35,321,397 T153A possibly damaging Het
Ina A C 19: 47,023,499 E452A probably benign Het
Kars A G 8: 111,994,862 probably null Het
Kif1c A G 11: 70,704,465 E124G probably damaging Het
Lpin3 T C 2: 160,904,024 probably benign Het
Lrp1 A T 10: 127,555,009 C3006* probably null Het
Lyst T C 13: 13,709,386 L2953P probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Melk T C 4: 44,308,906 Y88H probably damaging Het
Myrf A G 19: 10,211,797 S857P probably damaging Het
Nos2 A G 11: 78,935,361 I153M possibly damaging Het
Olfr732 T G 14: 50,281,913 L113F probably benign Het
Otof A G 5: 30,371,881 probably benign Het
Patl2 A G 2: 122,125,308 V249A probably damaging Het
Pcgf5 A G 19: 36,412,180 Y19C probably benign Het
Pcnt A T 10: 76,412,107 V951E probably damaging Het
Pcolce2 T C 9: 95,638,657 V29A probably benign Het
Pdgfrb A T 18: 61,077,703 M761L probably benign Het
Pi16 A T 17: 29,319,215 M1L possibly damaging Het
Pkd2 T A 5: 104,455,605 probably benign Het
Plcb2 A G 2: 118,717,325 W474R probably benign Het
Psapl1 A G 5: 36,204,280 D72G possibly damaging Het
Ptpn5 T A 7: 47,078,933 probably benign Het
Ptprg A G 14: 12,215,896 E1115G probably damaging Het
Rassf1 C T 9: 107,557,966 T224I probably damaging Het
Rbpms2 T A 9: 65,659,194 C168* probably null Het
Rhag A G 17: 40,828,913 probably benign Het
Rhebl1 C T 15: 98,881,153 V17I probably benign Het
Rnf130 A T 11: 50,095,876 D349V possibly damaging Het
Rprd1a A G 18: 24,509,895 L60P probably damaging Het
Ruvbl2 C T 7: 45,422,197 V421M probably damaging Het
Sap30 T C 8: 57,482,966 N209D possibly damaging Het
Sfswap T C 5: 129,503,978 probably benign Het
Slc1a2 G A 2: 102,756,007 V319M probably damaging Het
Smad2 T C 18: 76,289,179 probably benign Het
Spdya T C 17: 71,562,590 probably null Het
Stk39 G A 2: 68,410,048 T113M probably damaging Het
Tanc1 A G 2: 59,796,038 probably benign Het
Tas2r122 T C 6: 132,711,811 K40E probably damaging Het
Tph2 G T 10: 115,174,134 probably benign Het
Trip12 G A 1: 84,751,548 S1083F probably damaging Het
Tsc2 A T 17: 24,626,727 C206S probably damaging Het
Tsc22d4 A G 5: 137,762,419 Q34R possibly damaging Het
Uroc1 G T 6: 90,338,564 M142I possibly damaging Het
Uso1 T C 5: 92,199,823 S766P probably benign Het
Usp21 G A 1: 171,283,746 probably benign Het
Usp48 T A 4: 137,633,126 I658K possibly damaging Het
Vmn1r206 T C 13: 22,620,413 H208R probably damaging Het
Vmn2r109 C T 17: 20,540,675 A807T probably damaging Het
Zfp329 A T 7: 12,810,452 C382S probably damaging Het
Zfp341 A G 2: 154,646,068 E817G probably benign Het
Other mutations in Rspry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rspry1 APN 8 94622986 start codon destroyed probably null 0.89
IGL00158:Rspry1 APN 8 94622980 intron probably benign
IGL01141:Rspry1 APN 8 94649855 missense probably benign 0.00
IGL01860:Rspry1 APN 8 94649816 missense probably benign 0.00
IGL02174:Rspry1 APN 8 94633140 missense possibly damaging 0.84
IGL02819:Rspry1 APN 8 94654256 missense probably benign 0.42
IGL02926:Rspry1 APN 8 94649811 missense probably damaging 1.00
IGL03366:Rspry1 APN 8 94650334 missense probably benign 0.00
R1833:Rspry1 UTSW 8 94635488 missense probably damaging 1.00
R1988:Rspry1 UTSW 8 94632054 critical splice acceptor site probably null
R2444:Rspry1 UTSW 8 94623107 missense probably damaging 1.00
R3623:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R3624:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R4275:Rspry1 UTSW 8 94649761 missense probably benign 0.00
R4888:Rspry1 UTSW 8 94658789 missense probably benign 0.19
R5026:Rspry1 UTSW 8 94650303 missense probably damaging 1.00
R5310:Rspry1 UTSW 8 94623185 missense probably benign
R5374:Rspry1 UTSW 8 94623008 missense probably benign 0.00
R5374:Rspry1 UTSW 8 94654264 missense probably benign 0.38
R5387:Rspry1 UTSW 8 94638286 missense possibly damaging 0.95
R5517:Rspry1 UTSW 8 94636760 splice site probably null
R5631:Rspry1 UTSW 8 94629078 start codon destroyed possibly damaging 0.79
R5653:Rspry1 UTSW 8 94636611 splice site probably null
R6065:Rspry1 UTSW 8 94622987 start codon destroyed probably null 0.98
R6220:Rspry1 UTSW 8 94658750 missense probably damaging 1.00
R6276:Rspry1 UTSW 8 94623258 missense probably damaging 1.00
R6821:Rspry1 UTSW 8 94635431 nonsense probably null
R7390:Rspry1 UTSW 8 94623185 missense probably benign
R7460:Rspry1 UTSW 8 94650335 missense probably benign 0.00
R7644:Rspry1 UTSW 8 94658768 missense probably benign 0.00
R7717:Rspry1 UTSW 8 94623122 missense probably damaging 1.00
R7768:Rspry1 UTSW 8 94629841 missense probably damaging 1.00
X0010:Rspry1 UTSW 8 94629801 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CCAGTCATCAGACACCTGTAACAGAGT -3'
(R):5'- TGAAGACTGTCCTCGCAAAAGCAAA -3'

Sequencing Primer
(F):5'- GCCACAGCATAAAGGCCTAA -3'
(R):5'- cgctgagccatctctcc -3'
Posted On2013-06-11