Mutagenetix > Incidental Mutations

Incidental Mutation 'R0570:Fanca'

46384

Institutional Source

Beutler Lab

Gene Symbol

Fanca

Ensembl Gene

ENSMUSG00000032815

Gene Name

Fanconi anemia, complementation group A

Synonyms

MMRRC Submission

038761-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.528) question?

Stock #

R0570 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123268300-123318576 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 123306430 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 292 (S292R)

Ref Sequence

ENSEMBL: ENSMUSP00000113125 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035495] [ENSMUST00000118395] [ENSMUST00000127664] [ENSMUST00000127904]

Predicted Effect

probably benign
Transcript: ENSMUST00000035495
AA Change: S292R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815
AA Change: S292R

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	78	100	N/A	INTRINSIC
Pfam:Fanconi_A_N	167	520	3.7e-146	PFAM
low complexity region	645	660	N/A	INTRINSIC
low complexity region	778	790	N/A	INTRINSIC
low complexity region	1069	1079	N/A	INTRINSIC
low complexity region	1200	1225	N/A	INTRINSIC
Pfam:Fanconi_A	1246	1308	8.4e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000118395
AA Change: S292R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000113125
Gene: ENSMUSG00000032815
AA Change: S292R

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	78	100	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127904
AA Change: S194R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000116614
Gene: ENSMUSG00000032815
AA Change: S194R

Domain	Start	End	E-Value	Type
low complexity region	547	562	N/A	INTRINSIC
low complexity region	680	692	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155488

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212953

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 97.0%
20x: 94.3%

Validation Efficiency

100% (85/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700067K01Rik	C	A	8: 84,003,104		probably benign	Het
Aadacl3	C	T	4: 144,463,560	W57*	probably null	Het
Abca2	G	T	2: 25,447,405		probably null	Het
Abca3	A	G	17: 24,374,399	I257V	probably benign	Het
Adamts2	A	G	11: 50,776,136	D420G	probably damaging	Het
Adamts5	A	G	16: 85,899,247	F341L	probably damaging	Het
Ahnak	T	A	19: 9,013,698	D4115E	probably damaging	Het
Arhgap20	T	C	9: 51,840,451	S365P	possibly damaging	Het
Atrn	G	A	2: 130,980,134	V916I	probably benign	Het
Blmh	T	C	11: 76,965,825	V82A	probably damaging	Het
C1ra	A	T	6: 124,513,705	Y19F	probably benign	Het
Cactin	A	G	10: 81,323,233	E306G	probably damaging	Het
Celsr1	C	T	15: 85,903,365	R2724Q	probably benign	Het
Clca4b	T	C	3: 144,925,349	E250G	probably benign	Het
Col17a1	A	T	19: 47,665,878	S647T	possibly damaging	Het
Cope	T	A	8: 70,306,531	D74E	probably damaging	Het
Dsg1c	T	C	18: 20,270,378	I198T	probably damaging	Het
Elfn2	T	C	15: 78,673,234	N371S	probably damaging	Het
Elmo2	G	T	2: 165,304,919	A246D	probably benign	Het
Ewsr1	A	T	11: 5,085,935	M187K	possibly damaging	Het
Faap100	A	T	11: 120,374,288	S587R	possibly damaging	Het
Fam234b	C	T	6: 135,209,249	S85L	probably benign	Het
Fanci	G	A	7: 79,443,963	C1021Y	probably damaging	Het
Fhod3	T	C	18: 25,112,583	I1230T	probably benign	Het
Fmo5	T	C	3: 97,629,140	L27S	probably damaging	Het
Fmo9	A	G	1: 166,674,462	V147A	probably null	Het
Fnbp4	A	G	2: 90,752,957	Y309C	probably damaging	Het
Foxb1	T	C	9: 69,759,562	T229A	probably benign	Het
Gapvd1	A	G	2: 34,728,540	Y274H	probably damaging	Het
Gbp8	T	C	5: 105,017,675		probably null	Het
Gcn1l1	T	A	5: 115,592,421	L888Q	probably damaging	Het
Gm17490	T	C	2: 11,625,649		probably benign	Het
Gtf2ird2	T	A	5: 134,208,944		probably null	Het
H2-Q1	A	G	17: 35,321,397	T153A	possibly damaging	Het
Ina	A	C	19: 47,023,499	E452A	probably benign	Het
Kars	A	G	8: 111,994,862		probably null	Het
Kif1c	A	G	11: 70,704,465	E124G	probably damaging	Het
Lpin3	T	C	2: 160,904,024		probably benign	Het
Lrp1	A	T	10: 127,555,009	C3006*	probably null	Het
Lyst	T	C	13: 13,709,386	L2953P	probably benign	Het
Mb21d2	G	A	16: 28,929,572	A31V	probably benign	Het
Melk	T	C	4: 44,308,906	Y88H	probably damaging	Het
Myrf	A	G	19: 10,211,797	S857P	probably damaging	Het
Nos2	A	G	11: 78,935,361	I153M	possibly damaging	Het
Olfr732	T	G	14: 50,281,913	L113F	probably benign	Het
Otof	A	G	5: 30,371,881		probably benign	Het
Patl2	A	G	2: 122,125,308	V249A	probably damaging	Het
Pcgf5	A	G	19: 36,412,180	Y19C	probably benign	Het
Pcnt	A	T	10: 76,412,107	V951E	probably damaging	Het
Pcolce2	T	C	9: 95,638,657	V29A	probably benign	Het
Pdgfrb	A	T	18: 61,077,703	M761L	probably benign	Het
Pi16	A	T	17: 29,319,215	M1L	possibly damaging	Het
Pkd2	T	A	5: 104,455,605		probably benign	Het
Plcb2	A	G	2: 118,717,325	W474R	probably benign	Het
Psapl1	A	G	5: 36,204,280	D72G	possibly damaging	Het
Ptpn5	T	A	7: 47,078,933		probably benign	Het
Ptprg	A	G	14: 12,215,896	E1115G	probably damaging	Het
Rassf1	C	T	9: 107,557,966	T224I	probably damaging	Het
Rbpms2	T	A	9: 65,659,194	C168*	probably null	Het
Rhag	A	G	17: 40,828,913		probably benign	Het
Rhebl1	C	T	15: 98,881,153	V17I	probably benign	Het
Rnf130	A	T	11: 50,095,876	D349V	possibly damaging	Het
Rprd1a	A	G	18: 24,509,895	L60P	probably damaging	Het
Rspry1	T	C	8: 94,629,792	I25T	probably damaging	Het
Ruvbl2	C	T	7: 45,422,197	V421M	probably damaging	Het
Sap30	T	C	8: 57,482,966	N209D	possibly damaging	Het
Sfswap	T	C	5: 129,503,978		probably benign	Het
Slc1a2	G	A	2: 102,756,007	V319M	probably damaging	Het
Smad2	T	C	18: 76,289,179		probably benign	Het
Spdya	T	C	17: 71,562,590		probably null	Het
Stk39	G	A	2: 68,410,048	T113M	probably damaging	Het
Tanc1	A	G	2: 59,796,038		probably benign	Het
Tas2r122	T	C	6: 132,711,811	K40E	probably damaging	Het
Tph2	G	T	10: 115,174,134		probably benign	Het
Trip12	G	A	1: 84,751,548	S1083F	probably damaging	Het
Tsc2	A	T	17: 24,626,727	C206S	probably damaging	Het
Tsc22d4	A	G	5: 137,762,419	Q34R	possibly damaging	Het
Uroc1	G	T	6: 90,338,564	M142I	possibly damaging	Het
Uso1	T	C	5: 92,199,823	S766P	probably benign	Het
Usp21	G	A	1: 171,283,746		probably benign	Het
Usp48	T	A	4: 137,633,126	I658K	possibly damaging	Het
Vmn1r206	T	C	13: 22,620,413	H208R	probably damaging	Het
Vmn2r109	C	T	17: 20,540,675	A807T	probably damaging	Het
Zfp329	A	T	7: 12,810,452	C382S	probably damaging	Het
Zfp341	A	G	2: 154,646,068	E817G	probably benign	Het

Other mutations in Fanca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02348:Fanca	APN	8	123305263	missense	probably damaging	1.00
IGL02805:Fanca	APN	8	123289494	missense	probably damaging	0.99
IGL03280:Fanca	APN	8	123316459	unclassified	probably benign
PIT4402001:Fanca	UTSW	8	123313064	missense	possibly damaging	0.83
R0114:Fanca	UTSW	8	123288491	splice site	probably null
R0115:Fanca	UTSW	8	123268539	missense	probably benign	0.00
R0271:Fanca	UTSW	8	123272441	unclassified	probably benign
R0330:Fanca	UTSW	8	123274172	nonsense	probably null
R0345:Fanca	UTSW	8	123304813	missense	probably damaging	1.00
R0601:Fanca	UTSW	8	123308513	missense	probably damaging	0.99
R0617:Fanca	UTSW	8	123288070	missense	probably damaging	0.99
R0639:Fanca	UTSW	8	123289359	critical splice donor site	probably null
R0943:Fanca	UTSW	8	123274186	missense	probably damaging	1.00
R1140:Fanca	UTSW	8	123313129	splice site	probably null
R1364:Fanca	UTSW	8	123304281	splice site	probably benign
R1366:Fanca	UTSW	8	123304281	splice site	probably benign
R1367:Fanca	UTSW	8	123304281	splice site	probably benign
R1368:Fanca	UTSW	8	123304281	splice site	probably benign
R1969:Fanca	UTSW	8	123288064	missense	probably benign	0.41
R1992:Fanca	UTSW	8	123297812	missense	possibly damaging	0.94
R2060:Fanca	UTSW	8	123274481	missense	probably damaging	1.00
R2174:Fanca	UTSW	8	123271270	missense	probably benign	0.00
R2261:Fanca	UTSW	8	123289359	critical splice donor site	probably null
R3957:Fanca	UTSW	8	123316363	missense	probably benign	0.00
R4062:Fanca	UTSW	8	123275172	missense	probably benign	0.00
R4153:Fanca	UTSW	8	123304878	missense	possibly damaging	0.89
R4270:Fanca	UTSW	8	123268794	missense	probably damaging	1.00
R4424:Fanca	UTSW	8	123288793	missense	probably benign	0.11
R4581:Fanca	UTSW	8	123274338	splice site	probably null
R4639:Fanca	UTSW	8	123318150	missense	probably damaging	0.98
R4664:Fanca	UTSW	8	123268972	missense	probably damaging	0.99
R4665:Fanca	UTSW	8	123268972	missense	probably damaging	0.99
R4666:Fanca	UTSW	8	123268972	missense	probably damaging	0.99
R4686:Fanca	UTSW	8	123268934	splice site	probably benign
R4775:Fanca	UTSW	8	123296306	missense	probably damaging	0.99
R4782:Fanca	UTSW	8	123288202	missense	probably damaging	1.00
R4799:Fanca	UTSW	8	123288202	missense	probably damaging	1.00
R4926:Fanca	UTSW	8	123303985	missense	probably benign	0.05
R4973:Fanca	UTSW	8	123308522	missense	probably damaging	0.96
R5039:Fanca	UTSW	8	123284046	missense	probably benign
R5195:Fanca	UTSW	8	123303945	intron	probably benign
R5590:Fanca	UTSW	8	123303963	intron	probably benign
R5848:Fanca	UTSW	8	123295053	intron	probably benign
R5965:Fanca	UTSW	8	123316410	missense	possibly damaging	0.46
R6224:Fanca	UTSW	8	123305281	missense	possibly damaging	0.87
R6385:Fanca	UTSW	8	123305867	splice site	probably null
R6762:Fanca	UTSW	8	123271303	missense	probably benign	0.26
R6795:Fanca	UTSW	8	123318493	missense	probably benign	0.02
R6810:Fanca	UTSW	8	123286477	missense	probably damaging	0.99
R7153:Fanca	UTSW	8	123316425	missense	probably damaging	1.00
R7170:Fanca	UTSW	8	123271206	missense	probably damaging	1.00
R7204:Fanca	UTSW	8	123286477	missense	probably damaging	0.98
R7366:Fanca	UTSW	8	123281213	missense	probably benign	0.08
R7599:Fanca	UTSW	8	123271260	missense	probably benign
R7639:Fanca	UTSW	8	123291395	critical splice donor site	probably null
R7650:Fanca	UTSW	8	123268564	splice site	probably null
R8066:Fanca	UTSW	8	123303940	missense	unknown
R8247:Fanca	UTSW	8	123283955	unclassified	probably benign
R8312:Fanca	UTSW	8	123269810	intron	probably benign
R8327:Fanca	UTSW	8	123313245	nonsense	probably null
V7732:Fanca	UTSW	8	123304281	splice site	probably benign
X0025:Fanca	UTSW	8	123276548	intron	probably benign
X0062:Fanca	UTSW	8	123304852	missense	possibly damaging	0.95
Z1177:Fanca	UTSW	8	123312629	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGGCTTTAGCAACAATCTTCCCCG -3'
(R):5'- AGCTGCCCTTAACTTTACAGCTCAC -3'

Sequencing Primer
(F):5'- CAACAATCTTCCCCGAGGTC -3'
(R):5'- TCCAGGGAGATTCTGGCTC -3'

Posted On

2013-06-11