Mutagenetix > Incidental Mutations

Incidental Mutation 'R0570:Rassf1'

46389

Institutional Source

Beutler Lab

Gene Symbol

Rassf1

Ensembl Gene

ENSMUSG00000010067

Gene Name

Ras association (RalGDS/AF-6) domain family member 1

Synonyms

123F protein, NORE2A, Rassf1A, Rassf1B, Rassf1C, RDA32, REH3P21

MMRRC Submission

038761-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R0570 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107551555-107562267 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 107557966 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 224 (T224I)

Ref Sequence

ENSEMBL: ENSMUSP00000113252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010211] [ENSMUST00000093786] [ENSMUST00000122225] [ENSMUST00000156198]

Predicted Effect

probably damaging
Transcript: ENSMUST00000010211
AA Change: T150I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000010211
Gene: ENSMUSG00000010067
AA Change: T150I

Domain	Start	End	E-Value	Type
low complexity region	98	115	N/A	INTRINSIC
RA	124	218	6.26e-24	SMART
PDB:4LGD\|H	219	264	3e-13	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000093786
AA Change: T220I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000091301
Gene: ENSMUSG00000010067
AA Change: T220I

Domain	Start	End	E-Value	Type
C1	44	101	4.7e-7	SMART
low complexity region	168	185	N/A	INTRINSIC
RA	194	288	6.26e-24	SMART
PDB:4LGD\|H	289	334	3e-12	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000121635

SMART Domains

Protein: ENSMUSP00000113037
Gene: ENSMUSG00000010067

Domain	Start	End	E-Value	Type
low complexity region	50	67	N/A	INTRINSIC
RA	76	170	6.26e-24	SMART
PDB:4LGD\|H	171	216	1e-13	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000122225
AA Change: T224I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113252
Gene: ENSMUSG00000010067
AA Change: T224I

Domain	Start	End	E-Value	Type
C1	44	105	1.92e-3	SMART
low complexity region	172	189	N/A	INTRINSIC
RA	198	292	6.26e-24	SMART
Pfam:Nore1-SARAH	299	338	4.2e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125080

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125386

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129320

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144129

Predicted Effect

probably benign
Transcript: ENSMUST00000156198

SMART Domains

Protein: ENSMUSP00000117722
Gene: ENSMUSG00000010067

Domain	Start	End	E-Value	Type
Blast:C1	44	83	6e-24	BLAST
SCOP:d1ptq__	52	82	5e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180865

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181099

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191832

Meta Mutation Damage Score

0.8626

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 97.0%
20x: 94.3%

Validation Efficiency

100% (85/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to the RAS effector proteins. Loss or altered expression of this gene has been associated with the pathogenesis of a variety of cancers, which suggests the tumor suppressor function of this gene. The inactivation of this gene was found to be correlated with the hypermethylation of its CpG-island promoter region. The encoded protein was found to interact with DNA repair protein XPA. The protein was also shown to inhibit the accumulation of cyclin D1, and thus induce cell cycle arrest. Several alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous and heterozygous null mice display increased tumor incidence, especially of lung adenomas and lymphomas, and increased sensitivity to chemically induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700067K01Rik	C	A	8: 84,003,104		probably benign	Het
Aadacl3	C	T	4: 144,463,560	W57*	probably null	Het
Abca2	G	T	2: 25,447,405		probably null	Het
Abca3	A	G	17: 24,374,399	I257V	probably benign	Het
Adamts2	A	G	11: 50,776,136	D420G	probably damaging	Het
Adamts5	A	G	16: 85,899,247	F341L	probably damaging	Het
Ahnak	T	A	19: 9,013,698	D4115E	probably damaging	Het
Arhgap20	T	C	9: 51,840,451	S365P	possibly damaging	Het
Atrn	G	A	2: 130,980,134	V916I	probably benign	Het
Blmh	T	C	11: 76,965,825	V82A	probably damaging	Het
C1ra	A	T	6: 124,513,705	Y19F	probably benign	Het
Cactin	A	G	10: 81,323,233	E306G	probably damaging	Het
Celsr1	C	T	15: 85,903,365	R2724Q	probably benign	Het
Clca4b	T	C	3: 144,925,349	E250G	probably benign	Het
Col17a1	A	T	19: 47,665,878	S647T	possibly damaging	Het
Cope	T	A	8: 70,306,531	D74E	probably damaging	Het
Dsg1c	T	C	18: 20,270,378	I198T	probably damaging	Het
Elfn2	T	C	15: 78,673,234	N371S	probably damaging	Het
Elmo2	G	T	2: 165,304,919	A246D	probably benign	Het
Ewsr1	A	T	11: 5,085,935	M187K	possibly damaging	Het
Faap100	A	T	11: 120,374,288	S587R	possibly damaging	Het
Fam234b	C	T	6: 135,209,249	S85L	probably benign	Het
Fanca	A	T	8: 123,306,430	S292R	probably benign	Het
Fanci	G	A	7: 79,443,963	C1021Y	probably damaging	Het
Fhod3	T	C	18: 25,112,583	I1230T	probably benign	Het
Fmo5	T	C	3: 97,629,140	L27S	probably damaging	Het
Fmo9	A	G	1: 166,674,462	V147A	probably null	Het
Fnbp4	A	G	2: 90,752,957	Y309C	probably damaging	Het
Foxb1	T	C	9: 69,759,562	T229A	probably benign	Het
Gapvd1	A	G	2: 34,728,540	Y274H	probably damaging	Het
Gbp8	T	C	5: 105,017,675		probably null	Het
Gcn1l1	T	A	5: 115,592,421	L888Q	probably damaging	Het
Gm17490	T	C	2: 11,625,649		probably benign	Het
Gtf2ird2	T	A	5: 134,208,944		probably null	Het
H2-Q1	A	G	17: 35,321,397	T153A	possibly damaging	Het
Ina	A	C	19: 47,023,499	E452A	probably benign	Het
Kars	A	G	8: 111,994,862		probably null	Het
Kif1c	A	G	11: 70,704,465	E124G	probably damaging	Het
Lpin3	T	C	2: 160,904,024		probably benign	Het
Lrp1	A	T	10: 127,555,009	C3006*	probably null	Het
Lyst	T	C	13: 13,709,386	L2953P	probably benign	Het
Mb21d2	G	A	16: 28,929,572	A31V	probably benign	Het
Melk	T	C	4: 44,308,906	Y88H	probably damaging	Het
Myrf	A	G	19: 10,211,797	S857P	probably damaging	Het
Nos2	A	G	11: 78,935,361	I153M	possibly damaging	Het
Olfr732	T	G	14: 50,281,913	L113F	probably benign	Het
Otof	A	G	5: 30,371,881		probably benign	Het
Patl2	A	G	2: 122,125,308	V249A	probably damaging	Het
Pcgf5	A	G	19: 36,412,180	Y19C	probably benign	Het
Pcnt	A	T	10: 76,412,107	V951E	probably damaging	Het
Pcolce2	T	C	9: 95,638,657	V29A	probably benign	Het
Pdgfrb	A	T	18: 61,077,703	M761L	probably benign	Het
Pi16	A	T	17: 29,319,215	M1L	possibly damaging	Het
Pkd2	T	A	5: 104,455,605		probably benign	Het
Plcb2	A	G	2: 118,717,325	W474R	probably benign	Het
Psapl1	A	G	5: 36,204,280	D72G	possibly damaging	Het
Ptpn5	T	A	7: 47,078,933		probably benign	Het
Ptprg	A	G	14: 12,215,896	E1115G	probably damaging	Het
Rbpms2	T	A	9: 65,659,194	C168*	probably null	Het
Rhag	A	G	17: 40,828,913		probably benign	Het
Rhebl1	C	T	15: 98,881,153	V17I	probably benign	Het
Rnf130	A	T	11: 50,095,876	D349V	possibly damaging	Het
Rprd1a	A	G	18: 24,509,895	L60P	probably damaging	Het
Rspry1	T	C	8: 94,629,792	I25T	probably damaging	Het
Ruvbl2	C	T	7: 45,422,197	V421M	probably damaging	Het
Sap30	T	C	8: 57,482,966	N209D	possibly damaging	Het
Sfswap	T	C	5: 129,503,978		probably benign	Het
Slc1a2	G	A	2: 102,756,007	V319M	probably damaging	Het
Smad2	T	C	18: 76,289,179		probably benign	Het
Spdya	T	C	17: 71,562,590		probably null	Het
Stk39	G	A	2: 68,410,048	T113M	probably damaging	Het
Tanc1	A	G	2: 59,796,038		probably benign	Het
Tas2r122	T	C	6: 132,711,811	K40E	probably damaging	Het
Tph2	G	T	10: 115,174,134		probably benign	Het
Trip12	G	A	1: 84,751,548	S1083F	probably damaging	Het
Tsc2	A	T	17: 24,626,727	C206S	probably damaging	Het
Tsc22d4	A	G	5: 137,762,419	Q34R	possibly damaging	Het
Uroc1	G	T	6: 90,338,564	M142I	possibly damaging	Het
Uso1	T	C	5: 92,199,823	S766P	probably benign	Het
Usp21	G	A	1: 171,283,746		probably benign	Het
Usp48	T	A	4: 137,633,126	I658K	possibly damaging	Het
Vmn1r206	T	C	13: 22,620,413	H208R	probably damaging	Het
Vmn2r109	C	T	17: 20,540,675	A807T	probably damaging	Het
Zfp329	A	T	7: 12,810,452	C382S	probably damaging	Het
Zfp341	A	G	2: 154,646,068	E817G	probably benign	Het

Other mutations in Rassf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00940:Rassf1	APN	9	107558311	splice site	probably benign
R1548:Rassf1	UTSW	9	107551846	missense	probably benign	0.00
R1826:Rassf1	UTSW	9	107558193	missense	probably damaging	0.99
R2312:Rassf1	UTSW	9	107557550	missense	probably damaging	1.00
R2899:Rassf1	UTSW	9	107554194	missense	probably null	0.00
R3902:Rassf1	UTSW	9	107554840	missense	probably damaging	1.00
R4705:Rassf1	UTSW	9	107557867	missense	probably benign	0.04
R5491:Rassf1	UTSW	9	107561415	missense	possibly damaging	0.95
R5733:Rassf1	UTSW	9	107558014	missense	probably damaging	1.00
R5863:Rassf1	UTSW	9	107557824	missense	probably damaging	1.00
R5986:Rassf1	UTSW	9	107551822	missense	possibly damaging	0.51
R7571:Rassf1	UTSW	9	107551783	missense	possibly damaging	0.70
R7841:Rassf1	UTSW	9	107561545	makesense	probably null
R8086:Rassf1	UTSW	9	107557974	missense	probably benign	0.38

Predicted Primers

PCR Primer
(F):5'- TAGTGCGTCCTGTTTCAGTGCC -3'
(R):5'- TGCAAGAAGCCGCAGCTTCAAG -3'

Sequencing Primer
(F):5'- TCAGTGCCTTCCAGCAAG -3'
(R):5'- TTAAAGACAGACTCAGGTGGCTC -3'

Posted On

2013-06-11