Incidental Mutation 'R0570:Lrp1'
ID46393
Institutional Source Beutler Lab
Gene Symbol Lrp1
Ensembl Gene ENSMUSG00000040249
Gene Namelow density lipoprotein receptor-related protein 1
SynonymsA2mr, b2b1554Clo, CD91
MMRRC Submission 038761-MU
Accession Numbers

NCBI RefSeq: NM_008512.2; MGI:96828

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0570 (G1)
Quality Score177
Status Validated
Chromosome10
Chromosomal Location127538161-127621148 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 127555009 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 3006 (C3006*)
Ref Sequence ENSEMBL: ENSMUSP00000044004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049149]
Predicted Effect probably null
Transcript: ENSMUST00000049149
AA Change: C3006*
SMART Domains Protein: ENSMUSP00000044004
Gene: ENSMUSG00000040249
AA Change: C3006*

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
LDLa 27 67 1.03e-15 SMART
LDLa 72 111 1.04e-11 SMART
EGF 115 150 8.78e-2 SMART
EGF_CA 151 190 4.49e-8 SMART
low complexity region 222 232 N/A INTRINSIC
LY 273 315 7.07e-6 SMART
LY 316 359 2.31e-10 SMART
LY 360 402 8.3e-12 SMART
EGF 478 521 9.93e-1 SMART
LY 552 594 8.84e-7 SMART
LY 595 638 6.54e-10 SMART
LY 641 690 2.5e-15 SMART
LY 691 734 1.06e-9 SMART
EGF 807 844 1.38e1 SMART
LDLa 854 893 3.39e-16 SMART
LDLa 895 934 1.73e-13 SMART
LDLa 936 974 4.47e-16 SMART
LDLa 976 1014 2.53e-15 SMART
LDLa 1015 1054 2.95e-16 SMART
LDLa 1062 1100 3.24e-13 SMART
LDLa 1104 1143 2.97e-12 SMART
LDLa 1145 1185 1.24e-9 SMART
EGF 1185 1223 4.97e-1 SMART
EGF 1227 1263 6.02e0 SMART
LY 1290 1332 3.76e-1 SMART
LY 1337 1379 8.56e-14 SMART
LY 1380 1424 8.43e-13 SMART
LY 1425 1469 3.05e-10 SMART
LY 1471 1513 3.88e-3 SMART
EGF 1540 1580 1.85e0 SMART
LY 1606 1650 2.83e-5 SMART
LY 1651 1695 2.01e-10 SMART
LY 1698 1735 1.87e-5 SMART
LY 1736 1777 3.54e-6 SMART
LY 1778 1820 4.17e1 SMART
EGF 1850 1888 1.24e-1 SMART
LY 1915 1957 3.2e-4 SMART
LY 1958 2000 2.33e-15 SMART
LY 2001 2044 7.45e-14 SMART
LY 2045 2087 3.87e-12 SMART
LY 2089 2131 1.37e0 SMART
EGF 2159 2196 1.66e1 SMART
LY 2276 2318 5.57e-4 SMART
LY 2324 2369 3.3e-6 SMART
LY 2370 2412 3.93e-13 SMART
LY 2413 2454 3.62e-3 SMART
EGF_like 2482 2519 3.16e1 SMART
LDLa 2524 2564 3.31e-10 SMART
LDLa 2566 2603 7.21e-11 SMART
LDLa 2605 2642 1.09e-10 SMART
LDLa 2660 2691 6.05e-4 SMART
LDLa 2696 2733 2.49e-14 SMART
LDLa 2734 2772 4.65e-14 SMART
LDLa 2774 2815 3.92e-12 SMART
LDLa 2818 2856 1.51e-13 SMART
LDLa 2858 2900 1.93e-11 SMART
LDLa 2904 2942 1.73e-13 SMART
EGF_CA 2941 2982 6.16e-6 SMART
EGF_CA 2983 3023 2.66e-10 SMART
LY 3050 3094 6.64e-11 SMART
LY 3095 3137 7.17e-16 SMART
LY 3138 3181 4.28e-14 SMART
LY 3182 3224 8.11e-15 SMART
LY 3225 3265 1.44e-6 SMART
EGF 3294 3332 1.02e-2 SMART
LDLa 3334 3372 2.25e-12 SMART
LDLa 3374 3411 9.81e-13 SMART
LDLa 3413 3451 9.81e-13 SMART
LDLa 3453 3492 5.67e-18 SMART
LDLa 3494 3534 7.15e-15 SMART
LDLa 3536 3573 1.79e-15 SMART
EGF_like 3575 3611 4.83e1 SMART
LDLa 3575 3612 1.92e-15 SMART
LDLa 3613 3650 1.18e-15 SMART
LDLa 3654 3693 7.55e-14 SMART
LDLa 3695 3734 1.14e-8 SMART
LDLa 3741 3779 6.28e-11 SMART
EGF 3785 3824 1.06e1 SMART
EGF 3828 3862 1.51e0 SMART
LY 3893 3935 9.43e0 SMART
LY 3951 3993 1.23e-14 SMART
LY 3994 4037 2.98e-13 SMART
LY 4038 4080 4.28e-14 SMART
EGF 4151 4184 3.76e-1 SMART
low complexity region 4185 4198 N/A INTRINSIC
EGF 4200 4233 3.82e-2 SMART
EGF 4236 4269 4.03e-1 SMART
EGF 4272 4305 5.2e-4 SMART
EGF 4308 4341 1.22e0 SMART
EGF_like 4344 4376 4.11e1 SMART
EGF 4377 4410 5.12e-3 SMART
transmembrane domain 4423 4445 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (85/85)
MGI Phenotype Strain: 2178192
Lethality: E10-E13
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor family of proteins. The encoded preproprotein is proteolytically processed by furin to generate 515 kDa and 85 kDa subunits that form the mature receptor (PMID: 8546712). This receptor is involved in several cellular processes, including intracellular signaling, lipid homeostasis, and clearance of apoptotic cells. In addition, the encoded protein is necessary for the alpha 2-macroglobulin-mediated clearance of secreted amyloid precursor protein and beta-amyloid, the main component of amyloid plaques found in Alzheimer patients. Expression of this gene decreases with age and has been found to be lower than controls in brain tissue from Alzheimer's disease patients. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality during late organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(42) : Targeted(9) Gene trapped(33)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik C A 8: 84,003,104 probably benign Het
Aadacl3 C T 4: 144,463,560 W57* probably null Het
Abca2 G T 2: 25,447,405 probably null Het
Abca3 A G 17: 24,374,399 I257V probably benign Het
Adamts2 A G 11: 50,776,136 D420G probably damaging Het
Adamts5 A G 16: 85,899,247 F341L probably damaging Het
Ahnak T A 19: 9,013,698 D4115E probably damaging Het
Arhgap20 T C 9: 51,840,451 S365P possibly damaging Het
Atrn G A 2: 130,980,134 V916I probably benign Het
Blmh T C 11: 76,965,825 V82A probably damaging Het
C1ra A T 6: 124,513,705 Y19F probably benign Het
Cactin A G 10: 81,323,233 E306G probably damaging Het
Celsr1 C T 15: 85,903,365 R2724Q probably benign Het
Clca4b T C 3: 144,925,349 E250G probably benign Het
Col17a1 A T 19: 47,665,878 S647T possibly damaging Het
Cope T A 8: 70,306,531 D74E probably damaging Het
Dsg1c T C 18: 20,270,378 I198T probably damaging Het
Elfn2 T C 15: 78,673,234 N371S probably damaging Het
Elmo2 G T 2: 165,304,919 A246D probably benign Het
Ewsr1 A T 11: 5,085,935 M187K possibly damaging Het
Faap100 A T 11: 120,374,288 S587R possibly damaging Het
Fam234b C T 6: 135,209,249 S85L probably benign Het
Fanca A T 8: 123,306,430 S292R probably benign Het
Fanci G A 7: 79,443,963 C1021Y probably damaging Het
Fhod3 T C 18: 25,112,583 I1230T probably benign Het
Fmo5 T C 3: 97,629,140 L27S probably damaging Het
Fmo9 A G 1: 166,674,462 V147A probably null Het
Fnbp4 A G 2: 90,752,957 Y309C probably damaging Het
Foxb1 T C 9: 69,759,562 T229A probably benign Het
Gapvd1 A G 2: 34,728,540 Y274H probably damaging Het
Gbp8 T C 5: 105,017,675 probably null Het
Gcn1l1 T A 5: 115,592,421 L888Q probably damaging Het
Gm17490 T C 2: 11,625,649 probably benign Het
Gtf2ird2 T A 5: 134,208,944 probably null Het
H2-Q1 A G 17: 35,321,397 T153A possibly damaging Het
Ina A C 19: 47,023,499 E452A probably benign Het
Kars A G 8: 111,994,862 probably null Het
Kif1c A G 11: 70,704,465 E124G probably damaging Het
Lpin3 T C 2: 160,904,024 probably benign Het
Lyst T C 13: 13,709,386 L2953P probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Melk T C 4: 44,308,906 Y88H probably damaging Het
Myrf A G 19: 10,211,797 S857P probably damaging Het
Nos2 A G 11: 78,935,361 I153M possibly damaging Het
Olfr732 T G 14: 50,281,913 L113F probably benign Het
Otof A G 5: 30,371,881 probably benign Het
Patl2 A G 2: 122,125,308 V249A probably damaging Het
Pcgf5 A G 19: 36,412,180 Y19C probably benign Het
Pcnt A T 10: 76,412,107 V951E probably damaging Het
Pcolce2 T C 9: 95,638,657 V29A probably benign Het
Pdgfrb A T 18: 61,077,703 M761L probably benign Het
Pi16 A T 17: 29,319,215 M1L possibly damaging Het
Pkd2 T A 5: 104,455,605 probably benign Het
Plcb2 A G 2: 118,717,325 W474R probably benign Het
Psapl1 A G 5: 36,204,280 D72G possibly damaging Het
Ptpn5 T A 7: 47,078,933 probably benign Het
Ptprg A G 14: 12,215,896 E1115G probably damaging Het
Rassf1 C T 9: 107,557,966 T224I probably damaging Het
Rbpms2 T A 9: 65,659,194 C168* probably null Het
Rhag A G 17: 40,828,913 probably benign Het
Rhebl1 C T 15: 98,881,153 V17I probably benign Het
Rnf130 A T 11: 50,095,876 D349V possibly damaging Het
Rprd1a A G 18: 24,509,895 L60P probably damaging Het
Rspry1 T C 8: 94,629,792 I25T probably damaging Het
Ruvbl2 C T 7: 45,422,197 V421M probably damaging Het
Sap30 T C 8: 57,482,966 N209D possibly damaging Het
Sfswap T C 5: 129,503,978 probably benign Het
Slc1a2 G A 2: 102,756,007 V319M probably damaging Het
Smad2 T C 18: 76,289,179 probably benign Het
Spdya T C 17: 71,562,590 probably null Het
Stk39 G A 2: 68,410,048 T113M probably damaging Het
Tanc1 A G 2: 59,796,038 probably benign Het
Tas2r122 T C 6: 132,711,811 K40E probably damaging Het
Tph2 G T 10: 115,174,134 probably benign Het
Trip12 G A 1: 84,751,548 S1083F probably damaging Het
Tsc2 A T 17: 24,626,727 C206S probably damaging Het
Tsc22d4 A G 5: 137,762,419 Q34R possibly damaging Het
Uroc1 G T 6: 90,338,564 M142I possibly damaging Het
Uso1 T C 5: 92,199,823 S766P probably benign Het
Usp21 G A 1: 171,283,746 probably benign Het
Usp48 T A 4: 137,633,126 I658K possibly damaging Het
Vmn1r206 T C 13: 22,620,413 H208R probably damaging Het
Vmn2r109 C T 17: 20,540,675 A807T probably damaging Het
Zfp329 A T 7: 12,810,452 C382S probably damaging Het
Zfp341 A G 2: 154,646,068 E817G probably benign Het
Other mutations in Lrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Lrp1 APN 10 127542205 missense possibly damaging 0.89
IGL01065:Lrp1 APN 10 127575038 missense probably benign 0.10
IGL01121:Lrp1 APN 10 127583853 nonsense probably null
IGL01360:Lrp1 APN 10 127545820 missense possibly damaging 0.93
IGL01402:Lrp1 APN 10 127595032 missense probably damaging 1.00
IGL01404:Lrp1 APN 10 127595032 missense probably damaging 1.00
IGL01411:Lrp1 APN 10 127581765 nonsense probably null
IGL01469:Lrp1 APN 10 127584414 missense probably damaging 1.00
IGL01552:Lrp1 APN 10 127588510 nonsense probably null
IGL01682:Lrp1 APN 10 127574978 missense probably benign 0.00
IGL01760:Lrp1 APN 10 127573501 missense probably benign 0.00
IGL01918:Lrp1 APN 10 127554589 missense probably damaging 0.99
IGL01989:Lrp1 APN 10 127578129 missense probably damaging 1.00
IGL02105:Lrp1 APN 10 127544579 missense probably damaging 1.00
IGL02158:Lrp1 APN 10 127554271 missense probably benign 0.02
IGL02164:Lrp1 APN 10 127563667 missense probably benign 0.39
IGL02337:Lrp1 APN 10 127576887 missense possibly damaging 0.87
IGL02425:Lrp1 APN 10 127571887 critical splice donor site probably null
IGL02493:Lrp1 APN 10 127581778 missense probably damaging 0.99
IGL02563:Lrp1 APN 10 127551686 missense probably damaging 1.00
IGL02590:Lrp1 APN 10 127552791 missense probably damaging 1.00
IGL02624:Lrp1 APN 10 127572422 missense probably damaging 0.98
IGL02625:Lrp1 APN 10 127574486 missense probably damaging 1.00
IGL02825:Lrp1 APN 10 127542605 missense probably damaging 1.00
IGL02880:Lrp1 APN 10 127540222 missense probably benign 0.12
IGL02900:Lrp1 APN 10 127576647 splice site probably benign
IGL02956:Lrp1 APN 10 127544559 missense probably benign 0.00
IGL02974:Lrp1 APN 10 127555016 missense probably damaging 0.99
IGL02983:Lrp1 APN 10 127550199 missense probably damaging 1.00
IGL03002:Lrp1 APN 10 127589636 missense probably damaging 1.00
IGL03091:Lrp1 APN 10 127559124 missense probably benign 0.30
IGL03109:Lrp1 APN 10 127566645 missense probably benign
IGL03194:Lrp1 APN 10 127568685 missense probably damaging 1.00
IGL03232:Lrp1 APN 10 127539376 missense probably damaging 1.00
extremis UTSW 10 127556988 missense probably benign 0.00
Jockey UTSW 10 127560136 missense probably damaging 1.00
peripheral UTSW 10 127610381 missense probably damaging 1.00
tangential UTSW 10 127593848 missense probably damaging 0.99
P0015:Lrp1 UTSW 10 127566663 missense probably damaging 0.99
PIT4519001:Lrp1 UTSW 10 127607974 missense possibly damaging 0.91
PIT4520001:Lrp1 UTSW 10 127607974 missense possibly damaging 0.91
R0004:Lrp1 UTSW 10 127541825 splice site probably null
R0034:Lrp1 UTSW 10 127545651 missense probably benign 0.42
R0091:Lrp1 UTSW 10 127540979 missense probably damaging 1.00
R0098:Lrp1 UTSW 10 127552738 missense probably benign
R0098:Lrp1 UTSW 10 127552738 missense probably benign
R0143:Lrp1 UTSW 10 127593942 missense probably damaging 1.00
R0372:Lrp1 UTSW 10 127592136 missense probably damaging 1.00
R0379:Lrp1 UTSW 10 127594969 missense probably damaging 1.00
R0445:Lrp1 UTSW 10 127590636 nonsense probably null
R0529:Lrp1 UTSW 10 127541594 splice site probably null
R0551:Lrp1 UTSW 10 127571958 missense probably benign
R0600:Lrp1 UTSW 10 127567383 missense probably benign 0.00
R0626:Lrp1 UTSW 10 127567364 missense probably damaging 1.00
R0647:Lrp1 UTSW 10 127571477 missense probably damaging 1.00
R0680:Lrp1 UTSW 10 127589661 missense probably damaging 1.00
R0792:Lrp1 UTSW 10 127567364 missense probably damaging 1.00
R0792:Lrp1 UTSW 10 127575286 missense probably benign 0.04
R0848:Lrp1 UTSW 10 127553362 splice site probably null
R0866:Lrp1 UTSW 10 127539278 missense probably damaging 1.00
R0918:Lrp1 UTSW 10 127593965 missense probably damaging 1.00
R1076:Lrp1 UTSW 10 127563797 splice site probably benign
R1107:Lrp1 UTSW 10 127557435 missense probably damaging 1.00
R1346:Lrp1 UTSW 10 127605866 missense probably damaging 1.00
R1403:Lrp1 UTSW 10 127581891 critical splice acceptor site probably null
R1403:Lrp1 UTSW 10 127581891 critical splice acceptor site probably null
R1496:Lrp1 UTSW 10 127539011 missense probably damaging 1.00
R1522:Lrp1 UTSW 10 127567364 missense probably damaging 1.00
R1522:Lrp1 UTSW 10 127575286 missense probably benign 0.04
R1525:Lrp1 UTSW 10 127539529 missense probably damaging 1.00
R1539:Lrp1 UTSW 10 127584381 splice site probably null
R1589:Lrp1 UTSW 10 127605606 missense probably benign 0.00
R1591:Lrp1 UTSW 10 127605606 missense probably benign 0.00
R1663:Lrp1 UTSW 10 127556921 missense probably damaging 1.00
R1682:Lrp1 UTSW 10 127574332 missense probably damaging 1.00
R1717:Lrp1 UTSW 10 127556269 missense possibly damaging 0.59
R1717:Lrp1 UTSW 10 127563665 missense probably damaging 1.00
R1758:Lrp1 UTSW 10 127588584 missense possibly damaging 0.76
R1826:Lrp1 UTSW 10 127553707 missense probably damaging 1.00
R1842:Lrp1 UTSW 10 127573468 missense possibly damaging 0.93
R1844:Lrp1 UTSW 10 127595283 critical splice donor site probably null
R1845:Lrp1 UTSW 10 127578673 missense probably damaging 1.00
R1896:Lrp1 UTSW 10 127559998 missense possibly damaging 0.64
R1952:Lrp1 UTSW 10 127567431 missense probably damaging 1.00
R2009:Lrp1 UTSW 10 127544516 missense probably damaging 1.00
R2015:Lrp1 UTSW 10 127540694 missense probably benign 0.00
R2116:Lrp1 UTSW 10 127576493 nonsense probably null
R2161:Lrp1 UTSW 10 127555738 missense probably damaging 1.00
R2199:Lrp1 UTSW 10 127546840 missense probably damaging 1.00
R2213:Lrp1 UTSW 10 127540702 missense probably damaging 1.00
R2300:Lrp1 UTSW 10 127556915 nonsense probably null
R2324:Lrp1 UTSW 10 127566586 missense possibly damaging 0.92
R2849:Lrp1 UTSW 10 127542296 missense probably damaging 1.00
R2926:Lrp1 UTSW 10 127588113 missense probably damaging 0.98
R2993:Lrp1 UTSW 10 127610381 missense probably damaging 1.00
R3522:Lrp1 UTSW 10 127553555 missense probably damaging 1.00
R3702:Lrp1 UTSW 10 127595103 missense probably damaging 1.00
R3789:Lrp1 UTSW 10 127571969 missense possibly damaging 0.94
R3898:Lrp1 UTSW 10 127592100 nonsense probably null
R3941:Lrp1 UTSW 10 127553396 missense probably damaging 1.00
R3958:Lrp1 UTSW 10 127571958 missense probably benign
R4369:Lrp1 UTSW 10 127550286 missense possibly damaging 0.87
R4510:Lrp1 UTSW 10 127593848 missense probably damaging 0.99
R4511:Lrp1 UTSW 10 127593848 missense probably damaging 0.99
R4576:Lrp1 UTSW 10 127540188 small deletion probably benign
R4583:Lrp1 UTSW 10 127541372 missense probably benign 0.00
R4662:Lrp1 UTSW 10 127552185 nonsense probably null
R4721:Lrp1 UTSW 10 127555059 missense possibly damaging 0.58
R4728:Lrp1 UTSW 10 127563737 missense probably damaging 1.00
R4745:Lrp1 UTSW 10 127549944 missense probably benign 0.20
R4785:Lrp1 UTSW 10 127558133 missense probably benign 0.12
R4841:Lrp1 UTSW 10 127583936 missense probably damaging 1.00
R4842:Lrp1 UTSW 10 127583936 missense probably damaging 1.00
R4855:Lrp1 UTSW 10 127610442 missense probably benign 0.03
R4860:Lrp1 UTSW 10 127553824 missense probably damaging 1.00
R4860:Lrp1 UTSW 10 127553824 missense probably damaging 1.00
R4891:Lrp1 UTSW 10 127541752 missense probably damaging 1.00
R4925:Lrp1 UTSW 10 127575075 nonsense probably null
R4970:Lrp1 UTSW 10 127539520 missense probably benign 0.11
R4999:Lrp1 UTSW 10 127553779 missense probably damaging 1.00
R5044:Lrp1 UTSW 10 127567495 missense probably damaging 1.00
R5127:Lrp1 UTSW 10 127539634 intron probably benign
R5188:Lrp1 UTSW 10 127607952 missense probably damaging 1.00
R5218:Lrp1 UTSW 10 127548619 missense probably damaging 1.00
R5225:Lrp1 UTSW 10 127556096 missense probably benign 0.04
R5291:Lrp1 UTSW 10 127593878 missense probably damaging 1.00
R5386:Lrp1 UTSW 10 127592114 missense probably damaging 1.00
R5395:Lrp1 UTSW 10 127595297 missense probably damaging 1.00
R5413:Lrp1 UTSW 10 127588067 critical splice donor site probably null
R5430:Lrp1 UTSW 10 127541061 missense probably damaging 0.99
R5499:Lrp1 UTSW 10 127572944 missense possibly damaging 0.58
R5526:Lrp1 UTSW 10 127555724 missense probably benign 0.37
R5580:Lrp1 UTSW 10 127588520 missense probably benign
R5583:Lrp1 UTSW 10 127588463 missense probably benign 0.08
R5599:Lrp1 UTSW 10 127593869 missense probably damaging 1.00
R5639:Lrp1 UTSW 10 127593839 missense probably damaging 0.99
R5677:Lrp1 UTSW 10 127574429 missense probably damaging 1.00
R5730:Lrp1 UTSW 10 127583834 missense probably benign 0.00
R5742:Lrp1 UTSW 10 127548347 missense probably damaging 0.98
R5764:Lrp1 UTSW 10 127595318 missense probably benign 0.41
R5864:Lrp1 UTSW 10 127567505 missense possibly damaging 0.58
R5937:Lrp1 UTSW 10 127583876 missense possibly damaging 0.93
R5947:Lrp1 UTSW 10 127589554 critical splice donor site probably null
R5976:Lrp1 UTSW 10 127583901 missense probably damaging 1.00
R6021:Lrp1 UTSW 10 127578014 missense probably damaging 1.00
R6026:Lrp1 UTSW 10 127573403 missense probably damaging 1.00
R6045:Lrp1 UTSW 10 127566600 missense probably damaging 0.98
R6057:Lrp1 UTSW 10 127567490 missense probably damaging 1.00
R6084:Lrp1 UTSW 10 127560553 missense probably benign 0.09
R6131:Lrp1 UTSW 10 127560157 missense probably benign
R6235:Lrp1 UTSW 10 127588177 missense probably damaging 1.00
R6280:Lrp1 UTSW 10 127589584 missense probably benign 0.04
R6307:Lrp1 UTSW 10 127592075 missense probably damaging 1.00
R6532:Lrp1 UTSW 10 127541682 missense probably damaging 1.00
R6532:Lrp1 UTSW 10 127549407 missense probably damaging 1.00
R6536:Lrp1 UTSW 10 127558068 splice site probably null
R6605:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6607:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6631:Lrp1 UTSW 10 127574332 missense probably damaging 1.00
R6676:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6678:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6809:Lrp1 UTSW 10 127555056 missense probably benign 0.04
R6884:Lrp1 UTSW 10 127559117 missense probably benign 0.00
R6925:Lrp1 UTSW 10 127556988 missense probably benign 0.00
R6987:Lrp1 UTSW 10 127575005 missense probably damaging 1.00
R7016:Lrp1 UTSW 10 127559967 critical splice donor site probably null
R7030:Lrp1 UTSW 10 127552876 missense probably damaging 0.97
R7053:Lrp1 UTSW 10 127541094 missense probably damaging 1.00
R7076:Lrp1 UTSW 10 127550183 critical splice donor site probably null
R7136:Lrp1 UTSW 10 127558622 missense probably damaging 1.00
R7180:Lrp1 UTSW 10 127556965 missense probably damaging 1.00
R7199:Lrp1 UTSW 10 127573456 missense probably damaging 0.99
R7219:Lrp1 UTSW 10 127557228 missense probably benign 0.40
R7233:Lrp1 UTSW 10 127595061 missense probably damaging 1.00
R7251:Lrp1 UTSW 10 127572554 missense probably damaging 1.00
R7264:Lrp1 UTSW 10 127592093 missense probably damaging 1.00
R7302:Lrp1 UTSW 10 127538987 missense probably benign 0.01
R7313:Lrp1 UTSW 10 127553468 missense probably damaging 1.00
R7322:Lrp1 UTSW 10 127545564 missense probably benign 0.24
R7354:Lrp1 UTSW 10 127571408 missense probably damaging 1.00
R7375:Lrp1 UTSW 10 127539348 missense probably damaging 1.00
R7388:Lrp1 UTSW 10 127583897 nonsense probably null
R7404:Lrp1 UTSW 10 127582708 missense
R7405:Lrp1 UTSW 10 127581751 missense possibly damaging 0.93
R7477:Lrp1 UTSW 10 127568920 missense probably damaging 1.00
R7555:Lrp1 UTSW 10 127546862 missense probably damaging 1.00
R7600:Lrp1 UTSW 10 127555706 missense probably benign
R7678:Lrp1 UTSW 10 127574053 missense probably damaging 1.00
R7679:Lrp1 UTSW 10 127588428 nonsense probably null
R7951:Lrp1 UTSW 10 127539064 nonsense probably null
R7964:Lrp1 UTSW 10 127575044 missense possibly damaging 0.94
R8006:Lrp1 UTSW 10 127589619 missense probably damaging 1.00
R8021:Lrp1 UTSW 10 127548346 missense possibly damaging 0.92
R8098:Lrp1 UTSW 10 127574455 missense possibly damaging 0.78
R8112:Lrp1 UTSW 10 127605846 missense probably damaging 1.00
R8210:Lrp1 UTSW 10 127576485 missense probably damaging 1.00
R8249:Lrp1 UTSW 10 127605543 missense probably benign
R8291:Lrp1 UTSW 10 127589703 missense probably damaging 1.00
R8332:Lrp1 UTSW 10 127571936 missense probably damaging 1.00
R8435:Lrp1 UTSW 10 127556330 missense probably damaging 0.97
R8467:Lrp1 UTSW 10 127558650 missense probably damaging 1.00
R8468:Lrp1 UTSW 10 127558650 missense probably damaging 1.00
R8474:Lrp1 UTSW 10 127539703 missense probably damaging 1.00
R8481:Lrp1 UTSW 10 127568910 missense probably damaging 1.00
R8483:Lrp1 UTSW 10 127558650 missense probably damaging 1.00
R8485:Lrp1 UTSW 10 127558650 missense probably damaging 1.00
R8488:Lrp1 UTSW 10 127560487 missense probably damaging 1.00
V3553:Lrp1 UTSW 10 127571442 missense probably damaging 1.00
Y5406:Lrp1 UTSW 10 127554283 missense probably damaging 1.00
Z1088:Lrp1 UTSW 10 127584379 missense probably damaging 1.00
Z1176:Lrp1 UTSW 10 127554962 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAAAGATGAGAAATGGCTCCTC -3'
(R):5'- TGGTTCCCAGAAGCATAGACTCCAG -3'

Sequencing Primer
(F):5'- TGAGAAATGGCTCCTCATCTG -3'
(R):5'- ATAGACTCCAGCCGCTTCC -3'
Posted On2013-06-11