Mutagenetix > Incidental Mutations

Incidental Mutation 'R0570:Rnf130'

46395

Institutional Source

Beutler Lab

Gene Symbol

Rnf130

Ensembl Gene

ENSMUSG00000020376

Gene Name

ring finger protein 130

Synonyms

G1RZFP, G1RP, 2510042A13Rik

MMRRC Submission

038761-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R0570 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

50025346-50104758 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 50095876 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 349 (D349V)

Ref Sequence

ENSEMBL: ENSMUSP00000099837 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054684] [ENSMUST00000102776]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000054684
AA Change: D349V

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000056345
Gene: ENSMUSG00000020376
AA Change: D349V

Domain	Start	End	E-Value	Type
low complexity region	3	18	N/A	INTRINSIC
Pfam:PA	65	169	4.6e-13	PFAM
transmembrane domain	195	217	N/A	INTRINSIC
RING	264	304	5.51e-7	SMART
low complexity region	341	354	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102776
AA Change: D349V

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099837
Gene: ENSMUSG00000020376
AA Change: D349V

Domain	Start	End	E-Value	Type
low complexity region	3	18	N/A	INTRINSIC
Pfam:PA	69	167	8.1e-14	PFAM
transmembrane domain	195	217	N/A	INTRINSIC
RING	264	304	5.51e-7	SMART
low complexity region	341	354	N/A	INTRINSIC
transmembrane domain	387	409	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143607

Meta Mutation Damage Score

0.2011

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 97.0%
20x: 94.3%

Validation Efficiency

100% (85/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger motif and is similar to g1, a Drosophila zinc-finger protein that is expressed in mesoderm and involved in embryonic development. The expression of the mouse counterpart was found to be upregulated in myeloblastic cells following IL3 deprivation, suggesting that this gene may regulate growth factor withdrawal-induced apoptosis of myeloid precursor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700067K01Rik	C	A	8: 84,003,104		probably benign	Het
Aadacl3	C	T	4: 144,463,560	W57*	probably null	Het
Abca2	G	T	2: 25,447,405		probably null	Het
Abca3	A	G	17: 24,374,399	I257V	probably benign	Het
Adamts2	A	G	11: 50,776,136	D420G	probably damaging	Het
Adamts5	A	G	16: 85,899,247	F341L	probably damaging	Het
Ahnak	T	A	19: 9,013,698	D4115E	probably damaging	Het
Arhgap20	T	C	9: 51,840,451	S365P	possibly damaging	Het
Atrn	G	A	2: 130,980,134	V916I	probably benign	Het
Blmh	T	C	11: 76,965,825	V82A	probably damaging	Het
C1ra	A	T	6: 124,513,705	Y19F	probably benign	Het
Cactin	A	G	10: 81,323,233	E306G	probably damaging	Het
Celsr1	C	T	15: 85,903,365	R2724Q	probably benign	Het
Clca4b	T	C	3: 144,925,349	E250G	probably benign	Het
Col17a1	A	T	19: 47,665,878	S647T	possibly damaging	Het
Cope	T	A	8: 70,306,531	D74E	probably damaging	Het
Dsg1c	T	C	18: 20,270,378	I198T	probably damaging	Het
Elfn2	T	C	15: 78,673,234	N371S	probably damaging	Het
Elmo2	G	T	2: 165,304,919	A246D	probably benign	Het
Ewsr1	A	T	11: 5,085,935	M187K	possibly damaging	Het
Faap100	A	T	11: 120,374,288	S587R	possibly damaging	Het
Fam234b	C	T	6: 135,209,249	S85L	probably benign	Het
Fanca	A	T	8: 123,306,430	S292R	probably benign	Het
Fanci	G	A	7: 79,443,963	C1021Y	probably damaging	Het
Fhod3	T	C	18: 25,112,583	I1230T	probably benign	Het
Fmo5	T	C	3: 97,629,140	L27S	probably damaging	Het
Fmo9	A	G	1: 166,674,462	V147A	probably null	Het
Fnbp4	A	G	2: 90,752,957	Y309C	probably damaging	Het
Foxb1	T	C	9: 69,759,562	T229A	probably benign	Het
Gapvd1	A	G	2: 34,728,540	Y274H	probably damaging	Het
Gbp8	T	C	5: 105,017,675		probably null	Het
Gcn1l1	T	A	5: 115,592,421	L888Q	probably damaging	Het
Gm17490	T	C	2: 11,625,649		probably benign	Het
Gtf2ird2	T	A	5: 134,208,944		probably null	Het
H2-Q1	A	G	17: 35,321,397	T153A	possibly damaging	Het
Ina	A	C	19: 47,023,499	E452A	probably benign	Het
Kars	A	G	8: 111,994,862		probably null	Het
Kif1c	A	G	11: 70,704,465	E124G	probably damaging	Het
Lpin3	T	C	2: 160,904,024		probably benign	Het
Lrp1	A	T	10: 127,555,009	C3006*	probably null	Het
Lyst	T	C	13: 13,709,386	L2953P	probably benign	Het
Mb21d2	G	A	16: 28,929,572	A31V	probably benign	Het
Melk	T	C	4: 44,308,906	Y88H	probably damaging	Het
Myrf	A	G	19: 10,211,797	S857P	probably damaging	Het
Nos2	A	G	11: 78,935,361	I153M	possibly damaging	Het
Olfr732	T	G	14: 50,281,913	L113F	probably benign	Het
Otof	A	G	5: 30,371,881		probably benign	Het
Patl2	A	G	2: 122,125,308	V249A	probably damaging	Het
Pcgf5	A	G	19: 36,412,180	Y19C	probably benign	Het
Pcnt	A	T	10: 76,412,107	V951E	probably damaging	Het
Pcolce2	T	C	9: 95,638,657	V29A	probably benign	Het
Pdgfrb	A	T	18: 61,077,703	M761L	probably benign	Het
Pi16	A	T	17: 29,319,215	M1L	possibly damaging	Het
Pkd2	T	A	5: 104,455,605		probably benign	Het
Plcb2	A	G	2: 118,717,325	W474R	probably benign	Het
Psapl1	A	G	5: 36,204,280	D72G	possibly damaging	Het
Ptpn5	T	A	7: 47,078,933		probably benign	Het
Ptprg	A	G	14: 12,215,896	E1115G	probably damaging	Het
Rassf1	C	T	9: 107,557,966	T224I	probably damaging	Het
Rbpms2	T	A	9: 65,659,194	C168*	probably null	Het
Rhag	A	G	17: 40,828,913		probably benign	Het
Rhebl1	C	T	15: 98,881,153	V17I	probably benign	Het
Rprd1a	A	G	18: 24,509,895	L60P	probably damaging	Het
Rspry1	T	C	8: 94,629,792	I25T	probably damaging	Het
Ruvbl2	C	T	7: 45,422,197	V421M	probably damaging	Het
Sap30	T	C	8: 57,482,966	N209D	possibly damaging	Het
Sfswap	T	C	5: 129,503,978		probably benign	Het
Slc1a2	G	A	2: 102,756,007	V319M	probably damaging	Het
Smad2	T	C	18: 76,289,179		probably benign	Het
Spdya	T	C	17: 71,562,590		probably null	Het
Stk39	G	A	2: 68,410,048	T113M	probably damaging	Het
Tanc1	A	G	2: 59,796,038		probably benign	Het
Tas2r122	T	C	6: 132,711,811	K40E	probably damaging	Het
Tph2	G	T	10: 115,174,134		probably benign	Het
Trip12	G	A	1: 84,751,548	S1083F	probably damaging	Het
Tsc2	A	T	17: 24,626,727	C206S	probably damaging	Het
Tsc22d4	A	G	5: 137,762,419	Q34R	possibly damaging	Het
Uroc1	G	T	6: 90,338,564	M142I	possibly damaging	Het
Uso1	T	C	5: 92,199,823	S766P	probably benign	Het
Usp21	G	A	1: 171,283,746		probably benign	Het
Usp48	T	A	4: 137,633,126	I658K	possibly damaging	Het
Vmn1r206	T	C	13: 22,620,413	H208R	probably damaging	Het
Vmn2r109	C	T	17: 20,540,675	A807T	probably damaging	Het
Zfp329	A	T	7: 12,810,452	C382S	probably damaging	Het
Zfp341	A	G	2: 154,646,068	E817G	probably benign	Het

Other mutations in Rnf130

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Rnf130	APN	11	50093796	missense	probably damaging	1.00
IGL02364:Rnf130	APN	11	50095840	missense	probably benign
IGL02948:Rnf130	APN	11	50052771	splice site	probably benign
R0145:Rnf130	UTSW	11	50071219	missense	possibly damaging	0.89
R0358:Rnf130	UTSW	11	50071282	missense	probably benign	0.01
R0786:Rnf130	UTSW	11	50087437	missense	probably damaging	1.00
R1709:Rnf130	UTSW	11	50087386	missense	possibly damaging	0.80
R2312:Rnf130	UTSW	11	50087463	critical splice donor site	probably null
R2972:Rnf130	UTSW	11	50093800	nonsense	probably null
R4353:Rnf130	UTSW	11	50087440	missense	possibly damaging	0.83
R4398:Rnf130	UTSW	11	50071378	missense	probably benign	0.08
R5162:Rnf130	UTSW	11	50052895	missense	probably damaging	1.00
R5236:Rnf130	UTSW	11	50095978	missense	probably damaging	0.99
R5869:Rnf130	UTSW	11	50085815	splice site	probably null
R6432:Rnf130	UTSW	11	50095790	nonsense	probably null
R6865:Rnf130	UTSW	11	50071264	missense	probably damaging	1.00
R8209:Rnf130	UTSW	11	50071270	missense	probably benign	0.44
R8226:Rnf130	UTSW	11	50071270	missense	probably benign	0.44
R8293:Rnf130	UTSW	11	50095796	missense	probably benign	0.06
R8508:Rnf130	UTSW	11	50087437	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTTGTACATGACATCAGCCTCCC -3'
(R):5'- TCCTTTACAAAACTGCTGGACCACG -3'

Sequencing Primer
(F):5'- ACAGTAGTCTCCTTTGCCAAG -3'
(R):5'- AACTTTCTTCTTGCAGTCATCAG -3'

Posted On

2013-06-11