Incidental Mutation 'R0570:Nos2'
ID46399
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Namenitric oxide synthase 2, inducible
SynonymsiNOS, Nos-2, Nos2a, NOS-II
MMRRC Submission 038761-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0570 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78920787-78960254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78935361 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 153 (I153M)
Ref Sequence ENSEMBL: ENSMUSP00000018610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
PDB Structure
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DOMAIN (DELTA 114) (N-[(1,3-BENZODIOXOL-5-YL)METHYL]-1-[2-(1H-IMIDAZOL-1-YL)PYRIMIDIN-4-YL]-4-(METHOXYCARBONYL)-PIPERAZINE-2-ACETAMIDE COMPLEX [X-RAY DIFFRACTION]
MURINE INOSOXY DIMER WITH ISOTHIOUREA BOUND IN THE ACTIVE SITE [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND 4-AMINO TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND DIHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457F Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457A Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
inducible nitric oxide synthase with Chlorzoxazone bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 7-nitroindazole bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 6-nitroindazole bound [X-RAY DIFFRACTION]
>> 40 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000018610
AA Change: I153M

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: I153M

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209121
Predicted Effect probably benign
Transcript: ENSMUST00000214397
AA Change: I40M

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1086 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik C A 8: 84,003,104 probably benign Het
Aadacl3 C T 4: 144,463,560 W57* probably null Het
Abca2 G T 2: 25,447,405 probably null Het
Abca3 A G 17: 24,374,399 I257V probably benign Het
Adamts2 A G 11: 50,776,136 D420G probably damaging Het
Adamts5 A G 16: 85,899,247 F341L probably damaging Het
Ahnak T A 19: 9,013,698 D4115E probably damaging Het
Arhgap20 T C 9: 51,840,451 S365P possibly damaging Het
Atrn G A 2: 130,980,134 V916I probably benign Het
Blmh T C 11: 76,965,825 V82A probably damaging Het
C1ra A T 6: 124,513,705 Y19F probably benign Het
Cactin A G 10: 81,323,233 E306G probably damaging Het
Celsr1 C T 15: 85,903,365 R2724Q probably benign Het
Clca4b T C 3: 144,925,349 E250G probably benign Het
Col17a1 A T 19: 47,665,878 S647T possibly damaging Het
Cope T A 8: 70,306,531 D74E probably damaging Het
Dsg1c T C 18: 20,270,378 I198T probably damaging Het
Elfn2 T C 15: 78,673,234 N371S probably damaging Het
Elmo2 G T 2: 165,304,919 A246D probably benign Het
Ewsr1 A T 11: 5,085,935 M187K possibly damaging Het
Faap100 A T 11: 120,374,288 S587R possibly damaging Het
Fam234b C T 6: 135,209,249 S85L probably benign Het
Fanca A T 8: 123,306,430 S292R probably benign Het
Fanci G A 7: 79,443,963 C1021Y probably damaging Het
Fhod3 T C 18: 25,112,583 I1230T probably benign Het
Fmo5 T C 3: 97,629,140 L27S probably damaging Het
Fmo9 A G 1: 166,674,462 V147A probably null Het
Fnbp4 A G 2: 90,752,957 Y309C probably damaging Het
Foxb1 T C 9: 69,759,562 T229A probably benign Het
Gapvd1 A G 2: 34,728,540 Y274H probably damaging Het
Gbp8 T C 5: 105,017,675 probably null Het
Gcn1l1 T A 5: 115,592,421 L888Q probably damaging Het
Gm17490 T C 2: 11,625,649 probably benign Het
Gtf2ird2 T A 5: 134,208,944 probably null Het
H2-Q1 A G 17: 35,321,397 T153A possibly damaging Het
Ina A C 19: 47,023,499 E452A probably benign Het
Kars A G 8: 111,994,862 probably null Het
Kif1c A G 11: 70,704,465 E124G probably damaging Het
Lpin3 T C 2: 160,904,024 probably benign Het
Lrp1 A T 10: 127,555,009 C3006* probably null Het
Lyst T C 13: 13,709,386 L2953P probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Melk T C 4: 44,308,906 Y88H probably damaging Het
Myrf A G 19: 10,211,797 S857P probably damaging Het
Olfr732 T G 14: 50,281,913 L113F probably benign Het
Otof A G 5: 30,371,881 probably benign Het
Patl2 A G 2: 122,125,308 V249A probably damaging Het
Pcgf5 A G 19: 36,412,180 Y19C probably benign Het
Pcnt A T 10: 76,412,107 V951E probably damaging Het
Pcolce2 T C 9: 95,638,657 V29A probably benign Het
Pdgfrb A T 18: 61,077,703 M761L probably benign Het
Pi16 A T 17: 29,319,215 M1L possibly damaging Het
Pkd2 T A 5: 104,455,605 probably benign Het
Plcb2 A G 2: 118,717,325 W474R probably benign Het
Psapl1 A G 5: 36,204,280 D72G possibly damaging Het
Ptpn5 T A 7: 47,078,933 probably benign Het
Ptprg A G 14: 12,215,896 E1115G probably damaging Het
Rassf1 C T 9: 107,557,966 T224I probably damaging Het
Rbpms2 T A 9: 65,659,194 C168* probably null Het
Rhag A G 17: 40,828,913 probably benign Het
Rhebl1 C T 15: 98,881,153 V17I probably benign Het
Rnf130 A T 11: 50,095,876 D349V possibly damaging Het
Rprd1a A G 18: 24,509,895 L60P probably damaging Het
Rspry1 T C 8: 94,629,792 I25T probably damaging Het
Ruvbl2 C T 7: 45,422,197 V421M probably damaging Het
Sap30 T C 8: 57,482,966 N209D possibly damaging Het
Sfswap T C 5: 129,503,978 probably benign Het
Slc1a2 G A 2: 102,756,007 V319M probably damaging Het
Smad2 T C 18: 76,289,179 probably benign Het
Spdya T C 17: 71,562,590 probably null Het
Stk39 G A 2: 68,410,048 T113M probably damaging Het
Tanc1 A G 2: 59,796,038 probably benign Het
Tas2r122 T C 6: 132,711,811 K40E probably damaging Het
Tph2 G T 10: 115,174,134 probably benign Het
Trip12 G A 1: 84,751,548 S1083F probably damaging Het
Tsc2 A T 17: 24,626,727 C206S probably damaging Het
Tsc22d4 A G 5: 137,762,419 Q34R possibly damaging Het
Uroc1 G T 6: 90,338,564 M142I possibly damaging Het
Uso1 T C 5: 92,199,823 S766P probably benign Het
Usp21 G A 1: 171,283,746 probably benign Het
Usp48 T A 4: 137,633,126 I658K possibly damaging Het
Vmn1r206 T C 13: 22,620,413 H208R probably damaging Het
Vmn2r109 C T 17: 20,540,675 A807T probably damaging Het
Zfp329 A T 7: 12,810,452 C382S probably damaging Het
Zfp341 A G 2: 154,646,068 E817G probably benign Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78957452 missense probably damaging 0.96
IGL01503:Nos2 APN 11 78945863 splice site probably benign
IGL01789:Nos2 APN 11 78944657 splice site probably benign
IGL02797:Nos2 APN 11 78940344 missense probably damaging 1.00
IGL02968:Nos2 APN 11 78937637 missense probably damaging 1.00
R0035:Nos2 UTSW 11 78945727 missense probably damaging 1.00
R0265:Nos2 UTSW 11 78937602 missense probably damaging 0.98
R0441:Nos2 UTSW 11 78928583 missense probably benign 0.10
R0504:Nos2 UTSW 11 78940077 missense probably damaging 1.00
R1356:Nos2 UTSW 11 78952803 missense probably benign 0.00
R1538:Nos2 UTSW 11 78956570 missense probably benign 0.00
R3414:Nos2 UTSW 11 78957588 missense probably benign 0.14
R3418:Nos2 UTSW 11 78959695 missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78929776 missense probably benign 0.01
R4492:Nos2 UTSW 11 78950095 missense probably benign
R4632:Nos2 UTSW 11 78957591 missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78928630 missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78922314 missense probably benign
R5214:Nos2 UTSW 11 78955441 missense probably damaging 1.00
R5377:Nos2 UTSW 11 78957491 missense probably benign 0.00
R5777:Nos2 UTSW 11 78940152 missense probably null 1.00
R5834:Nos2 UTSW 11 78928579 missense probably benign 0.01
R5930:Nos2 UTSW 11 78937915 missense probably damaging 1.00
R6511:Nos2 UTSW 11 78955464 splice site probably null
R6706:Nos2 UTSW 11 78944723 missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78952954 missense probably damaging 0.99
R6762:Nos2 UTSW 11 78959748 missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78945266 missense possibly damaging 0.64
R6868:Nos2 UTSW 11 78957506 missense probably benign 0.02
R6917:Nos2 UTSW 11 78951227 missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78928579 missense probably benign 0.02
R7286:Nos2 UTSW 11 78929854 missense probably damaging 1.00
R7367:Nos2 UTSW 11 78950090 missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78936471 nonsense probably null
R7411:Nos2 UTSW 11 78944855 critical splice donor site probably null
R7469:Nos2 UTSW 11 78952971 missense possibly damaging 0.94
X0063:Nos2 UTSW 11 78922367 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATCGGCCCCTAGTAAGCGAAGAG -3'
(R):5'- ATGATGGCATGTGGTCCCCAAC -3'

Sequencing Primer
(F):5'- GTGGGTCACAAAGCCAGC -3'
(R):5'- GATGCCTCACCTCAGGGTTTAG -3'
Posted On2013-06-11