Mutagenetix > Incidental Mutations

Incidental Mutation 'R0570:Ptprg'

46403

Institutional Source

Beutler Lab

Gene Symbol

Ptprg

Ensembl Gene

ENSMUSG00000021745

Gene Name

protein tyrosine phosphatase, receptor type, G

Synonyms

5430405N12Rik, RPTPgamma

MMRRC Submission

038761-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0570 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11553532-12242041 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12215896 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1115 (E1115G)

Ref Sequence

ENSEMBL: ENSMUSP00000022264 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022264] [ENSMUST00000119888] [ENSMUST00000142917]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022264
AA Change: E1115G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022264
Gene: ENSMUSG00000021745
AA Change: E1115G

Domain	Start	End	E-Value	Type
Carb_anhydrase	60	321	6.38e-109	SMART
FN3	347	433	5.4e-7	SMART
low complexity region	474	484	N/A	INTRINSIC
low complexity region	515	525	N/A	INTRINSIC
coiled coil region	581	617	N/A	INTRINSIC
transmembrane domain	734	756	N/A	INTRINSIC
PTPc	844	1118	1.76e-136	SMART
PTPc	1146	1409	1.32e-85	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000119888
AA Change: E340G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000113679
Gene: ENSMUSG00000021745
AA Change: E340G

Domain	Start	End	E-Value	Type
PTPc	69	343	1.76e-136	SMART
PTPc	371	634	1.32e-85	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134290

Predicted Effect

probably benign
Transcript: ENSMUST00000142917

SMART Domains

Protein: ENSMUSP00000121268
Gene: ENSMUSG00000021745

Domain	Start	End	E-Value	Type
Carb_anhydrase	60	260	1.6e-50	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223890

Meta Mutation Damage Score

0.564

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 97.0%
20x: 94.3%

Validation Efficiency

100% (85/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this PTP contains a carbonic anhydrase-like (CAH) domain, which is also found in the extracellular region of PTPRBETA/ZETA. This gene is located in a chromosomal region that is frequently deleted in renal cell carcinoma and lung carcinoma, thus is thought to be a candidate tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal but exhibit minor behavioral changes including specific motor deficits, reduced latency to react in the tail flick test, enhanced sensory processing for acoustic stimuli, and reduced performance with cued fear conditioning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700067K01Rik	C	A	8: 84,003,104		probably benign	Het
Aadacl3	C	T	4: 144,463,560	W57*	probably null	Het
Abca2	G	T	2: 25,447,405		probably null	Het
Abca3	A	G	17: 24,374,399	I257V	probably benign	Het
Adamts2	A	G	11: 50,776,136	D420G	probably damaging	Het
Adamts5	A	G	16: 85,899,247	F341L	probably damaging	Het
Ahnak	T	A	19: 9,013,698	D4115E	probably damaging	Het
Arhgap20	T	C	9: 51,840,451	S365P	possibly damaging	Het
Atrn	G	A	2: 130,980,134	V916I	probably benign	Het
Blmh	T	C	11: 76,965,825	V82A	probably damaging	Het
C1ra	A	T	6: 124,513,705	Y19F	probably benign	Het
Cactin	A	G	10: 81,323,233	E306G	probably damaging	Het
Celsr1	C	T	15: 85,903,365	R2724Q	probably benign	Het
Clca4b	T	C	3: 144,925,349	E250G	probably benign	Het
Col17a1	A	T	19: 47,665,878	S647T	possibly damaging	Het
Cope	T	A	8: 70,306,531	D74E	probably damaging	Het
Dsg1c	T	C	18: 20,270,378	I198T	probably damaging	Het
Elfn2	T	C	15: 78,673,234	N371S	probably damaging	Het
Elmo2	G	T	2: 165,304,919	A246D	probably benign	Het
Ewsr1	A	T	11: 5,085,935	M187K	possibly damaging	Het
Faap100	A	T	11: 120,374,288	S587R	possibly damaging	Het
Fam234b	C	T	6: 135,209,249	S85L	probably benign	Het
Fanca	A	T	8: 123,306,430	S292R	probably benign	Het
Fanci	G	A	7: 79,443,963	C1021Y	probably damaging	Het
Fhod3	T	C	18: 25,112,583	I1230T	probably benign	Het
Fmo5	T	C	3: 97,629,140	L27S	probably damaging	Het
Fmo9	A	G	1: 166,674,462	V147A	probably null	Het
Fnbp4	A	G	2: 90,752,957	Y309C	probably damaging	Het
Foxb1	T	C	9: 69,759,562	T229A	probably benign	Het
Gapvd1	A	G	2: 34,728,540	Y274H	probably damaging	Het
Gbp8	T	C	5: 105,017,675		probably null	Het
Gcn1l1	T	A	5: 115,592,421	L888Q	probably damaging	Het
Gm17490	T	C	2: 11,625,649		probably benign	Het
Gtf2ird2	T	A	5: 134,208,944		probably null	Het
H2-Q1	A	G	17: 35,321,397	T153A	possibly damaging	Het
Ina	A	C	19: 47,023,499	E452A	probably benign	Het
Kars	A	G	8: 111,994,862		probably null	Het
Kif1c	A	G	11: 70,704,465	E124G	probably damaging	Het
Lpin3	T	C	2: 160,904,024		probably benign	Het
Lrp1	A	T	10: 127,555,009	C3006*	probably null	Het
Lyst	T	C	13: 13,709,386	L2953P	probably benign	Het
Mb21d2	G	A	16: 28,929,572	A31V	probably benign	Het
Melk	T	C	4: 44,308,906	Y88H	probably damaging	Het
Myrf	A	G	19: 10,211,797	S857P	probably damaging	Het
Nos2	A	G	11: 78,935,361	I153M	possibly damaging	Het
Olfr732	T	G	14: 50,281,913	L113F	probably benign	Het
Otof	A	G	5: 30,371,881		probably benign	Het
Patl2	A	G	2: 122,125,308	V249A	probably damaging	Het
Pcgf5	A	G	19: 36,412,180	Y19C	probably benign	Het
Pcnt	A	T	10: 76,412,107	V951E	probably damaging	Het
Pcolce2	T	C	9: 95,638,657	V29A	probably benign	Het
Pdgfrb	A	T	18: 61,077,703	M761L	probably benign	Het
Pi16	A	T	17: 29,319,215	M1L	possibly damaging	Het
Pkd2	T	A	5: 104,455,605		probably benign	Het
Plcb2	A	G	2: 118,717,325	W474R	probably benign	Het
Psapl1	A	G	5: 36,204,280	D72G	possibly damaging	Het
Ptpn5	T	A	7: 47,078,933		probably benign	Het
Rassf1	C	T	9: 107,557,966	T224I	probably damaging	Het
Rbpms2	T	A	9: 65,659,194	C168*	probably null	Het
Rhag	A	G	17: 40,828,913		probably benign	Het
Rhebl1	C	T	15: 98,881,153	V17I	probably benign	Het
Rnf130	A	T	11: 50,095,876	D349V	possibly damaging	Het
Rprd1a	A	G	18: 24,509,895	L60P	probably damaging	Het
Rspry1	T	C	8: 94,629,792	I25T	probably damaging	Het
Ruvbl2	C	T	7: 45,422,197	V421M	probably damaging	Het
Sap30	T	C	8: 57,482,966	N209D	possibly damaging	Het
Sfswap	T	C	5: 129,503,978		probably benign	Het
Slc1a2	G	A	2: 102,756,007	V319M	probably damaging	Het
Smad2	T	C	18: 76,289,179		probably benign	Het
Spdya	T	C	17: 71,562,590		probably null	Het
Stk39	G	A	2: 68,410,048	T113M	probably damaging	Het
Tanc1	A	G	2: 59,796,038		probably benign	Het
Tas2r122	T	C	6: 132,711,811	K40E	probably damaging	Het
Tph2	G	T	10: 115,174,134		probably benign	Het
Trip12	G	A	1: 84,751,548	S1083F	probably damaging	Het
Tsc2	A	T	17: 24,626,727	C206S	probably damaging	Het
Tsc22d4	A	G	5: 137,762,419	Q34R	possibly damaging	Het
Uroc1	G	T	6: 90,338,564	M142I	possibly damaging	Het
Uso1	T	C	5: 92,199,823	S766P	probably benign	Het
Usp21	G	A	1: 171,283,746		probably benign	Het
Usp48	T	A	4: 137,633,126	I658K	possibly damaging	Het
Vmn1r206	T	C	13: 22,620,413	H208R	probably damaging	Het
Vmn2r109	C	T	17: 20,540,675	A807T	probably damaging	Het
Zfp329	A	T	7: 12,810,452	C382S	probably damaging	Het
Zfp341	A	G	2: 154,646,068	E817G	probably benign	Het

Other mutations in Ptprg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Ptprg	APN	14	12215992	missense	probably damaging	1.00
IGL00484:Ptprg	APN	14	12215220	missense	probably damaging	0.99
IGL00847:Ptprg	APN	14	12215265	missense	probably damaging	1.00
IGL01089:Ptprg	APN	14	12215286	missense	probably damaging	0.97
IGL01382:Ptprg	APN	14	12237797	missense	probably benign	0.16
IGL01470:Ptprg	APN	14	12213702	nonsense	probably null
IGL01762:Ptprg	APN	14	12037386	missense	probably benign	0.00
IGL01886:Ptprg	APN	14	12179280	missense	probably benign	0.22
IGL01963:Ptprg	APN	14	12220661	missense	probably damaging	1.00
IGL02015:Ptprg	APN	14	12237782	missense	possibly damaging	0.46
IGL02086:Ptprg	APN	14	12110080	nonsense	probably null
IGL02197:Ptprg	APN	14	12220613	missense	probably damaging	0.98
IGL02341:Ptprg	APN	14	12154360	missense	probably benign	0.00
IGL02732:Ptprg	APN	14	12225617	critical splice donor site	probably null
IGL03011:Ptprg	APN	14	12219029	missense	probably damaging	1.00
IGL03261:Ptprg	APN	14	12225552	missense	probably damaging	0.99
R0038:Ptprg	UTSW	14	12213710	missense	probably damaging	1.00
R0383:Ptprg	UTSW	14	12219024	missense	possibly damaging	0.93
R0433:Ptprg	UTSW	14	12220620	missense	probably damaging	1.00
R0488:Ptprg	UTSW	14	12220653	missense	probably damaging	1.00
R0503:Ptprg	UTSW	14	12237138	missense	possibly damaging	0.89
R0520:Ptprg	UTSW	14	12199783	missense	possibly damaging	0.92
R0606:Ptprg	UTSW	14	12154131	missense	probably benign
R1086:Ptprg	UTSW	14	11952706	splice site	probably benign
R1468:Ptprg	UTSW	14	12190767	missense	probably benign	0.02
R1468:Ptprg	UTSW	14	12190767	missense	probably benign	0.02
R1519:Ptprg	UTSW	14	12220596	missense	probably damaging	1.00
R1662:Ptprg	UTSW	14	12207357	missense	probably damaging	1.00
R1714:Ptprg	UTSW	14	12213697	missense	probably damaging	1.00
R1716:Ptprg	UTSW	14	12154360	missense	probably benign	0.00
R1797:Ptprg	UTSW	14	12199743	missense	probably damaging	1.00
R1803:Ptprg	UTSW	14	12091410	splice site	probably null
R2104:Ptprg	UTSW	14	11952897	critical splice donor site	probably null
R2125:Ptprg	UTSW	14	12179283	missense	possibly damaging	0.74
R2126:Ptprg	UTSW	14	12154355	missense	probably benign
R2133:Ptprg	UTSW	14	12211637	missense	probably damaging	1.00
R2471:Ptprg	UTSW	14	12210327	missense	probably damaging	1.00
R2571:Ptprg	UTSW	14	12122135	missense	probably benign
R3821:Ptprg	UTSW	14	12226375	missense	probably benign	0.00
R4196:Ptprg	UTSW	14	12122002	missense	possibly damaging	0.51
R4392:Ptprg	UTSW	14	12142467	missense	possibly damaging	0.80
R4665:Ptprg	UTSW	14	12215288	missense	possibly damaging	0.90
R4730:Ptprg	UTSW	14	12213713	missense	probably damaging	1.00
R4737:Ptprg	UTSW	14	12226314	missense	probably damaging	1.00
R4764:Ptprg	UTSW	14	12122068	missense	probably benign	0.01
R4801:Ptprg	UTSW	14	11554233	utr 5 prime	probably benign
R4825:Ptprg	UTSW	14	12220654	missense	probably damaging	1.00
R4960:Ptprg	UTSW	14	12237837	missense	probably benign	0.07
R4972:Ptprg	UTSW	14	12226427	missense	possibly damaging	0.94
R4980:Ptprg	UTSW	14	12154421	missense	probably benign	0.16
R5004:Ptprg	UTSW	14	12220667	missense	probably damaging	1.00
R5058:Ptprg	UTSW	14	12037387	missense	possibly damaging	0.82
R5182:Ptprg	UTSW	14	12154174	missense	probably benign
R5258:Ptprg	UTSW	14	12142431	missense	probably benign	0.11
R5338:Ptprg	UTSW	14	12154111	missense	probably benign
R5353:Ptprg	UTSW	14	11554235	utr 5 prime	probably benign
R5373:Ptprg	UTSW	14	12213665	missense	probably benign	0.00
R5387:Ptprg	UTSW	14	12153873	missense	probably damaging	1.00
R5616:Ptprg	UTSW	14	12122120	missense	probably benign
R5623:Ptprg	UTSW	14	12153857	missense	probably damaging	1.00
R5976:Ptprg	UTSW	14	12211625	missense	probably damaging	0.96
R6027:Ptprg	UTSW	14	12220613	missense	possibly damaging	0.87
R6091:Ptprg	UTSW	14	12215979	missense	probably damaging	1.00
R6184:Ptprg	UTSW	14	12153943	missense	probably benign	0.00
R6234:Ptprg	UTSW	14	12213747	missense	probably damaging	1.00
R6318:Ptprg	UTSW	14	12237118	missense	probably damaging	1.00
R6324:Ptprg	UTSW	14	12226314	missense	probably damaging	1.00
R6334:Ptprg	UTSW	14	12166832	missense	probably damaging	1.00
R6646:Ptprg	UTSW	14	11962714	missense	probably damaging	1.00
R6647:Ptprg	UTSW	14	11962714	missense	probably damaging	1.00
R6992:Ptprg	UTSW	14	11962602	missense	probably damaging	1.00
R7088:Ptprg	UTSW	14	12207365	missense	probably damaging	1.00
R7250:Ptprg	UTSW	14	12166767	missense	probably benign	0.18
R7342:Ptprg	UTSW	14	12237151	missense	possibly damaging	0.90
R7358:Ptprg	UTSW	14	12154198	missense	possibly damaging	0.59
R7410:Ptprg	UTSW	14	11962657	missense	probably damaging	1.00
R7448:Ptprg	UTSW	14	12142461	missense	probably benign	0.12
R7514:Ptprg	UTSW	14	12179342	missense	possibly damaging	0.86
R7523:Ptprg	UTSW	14	12237130	missense	probably damaging	0.97
X0020:Ptprg	UTSW	14	12110070	frame shift	probably null
X0027:Ptprg	UTSW	14	12110070	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AAACGCTTGAGGTCAGTCTCTGTTC -3'
(R):5'- GCATTGCCGCATCTACTTGCAC -3'

Sequencing Primer
(F):5'- CTGTTCAGAGCAGTGTTAACC -3'
(R):5'- GCACACATCATGTACTCTGC -3'

Posted On

2013-06-11