Mutagenetix > Incidental Mutations

Incidental Mutation 'R0570:Adamts5'

46409

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

MMRRC Submission

038761-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.254) question?

Stock #

R0570 (G1)

Quality Score

142

Status

Validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85899247 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 341 (F341L)

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

AlphaFold

Q9R001

Predicted Effect

probably damaging
Transcript: ENSMUST00000023611
AA Change: F341L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: F341L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Meta Mutation Damage Score

0.8921

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 97.0%
20x: 94.3%

Validation Efficiency

100% (85/85)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700067K01Rik	C	A	8: 84,003,104		probably benign	Het
Aadacl3	C	T	4: 144,463,560	W57*	probably null	Het
Abca2	G	T	2: 25,447,405		probably null	Het
Abca3	A	G	17: 24,374,399	I257V	probably benign	Het
Adamts2	A	G	11: 50,776,136	D420G	probably damaging	Het
Ahnak	T	A	19: 9,013,698	D4115E	probably damaging	Het
Arhgap20	T	C	9: 51,840,451	S365P	possibly damaging	Het
Atrn	G	A	2: 130,980,134	V916I	probably benign	Het
Blmh	T	C	11: 76,965,825	V82A	probably damaging	Het
C1ra	A	T	6: 124,513,705	Y19F	probably benign	Het
Cactin	A	G	10: 81,323,233	E306G	probably damaging	Het
Celsr1	C	T	15: 85,903,365	R2724Q	probably benign	Het
Clca4b	T	C	3: 144,925,349	E250G	probably benign	Het
Col17a1	A	T	19: 47,665,878	S647T	possibly damaging	Het
Cope	T	A	8: 70,306,531	D74E	probably damaging	Het
Dsg1c	T	C	18: 20,270,378	I198T	probably damaging	Het
Elfn2	T	C	15: 78,673,234	N371S	probably damaging	Het
Elmo2	G	T	2: 165,304,919	A246D	probably benign	Het
Ewsr1	A	T	11: 5,085,935	M187K	possibly damaging	Het
Faap100	A	T	11: 120,374,288	S587R	possibly damaging	Het
Fam234b	C	T	6: 135,209,249	S85L	probably benign	Het
Fanca	A	T	8: 123,306,430	S292R	probably benign	Het
Fanci	G	A	7: 79,443,963	C1021Y	probably damaging	Het
Fhod3	T	C	18: 25,112,583	I1230T	probably benign	Het
Fmo5	T	C	3: 97,629,140	L27S	probably damaging	Het
Fmo9	A	G	1: 166,674,462	V147A	probably null	Het
Fnbp4	A	G	2: 90,752,957	Y309C	probably damaging	Het
Foxb1	T	C	9: 69,759,562	T229A	probably benign	Het
Gapvd1	A	G	2: 34,728,540	Y274H	probably damaging	Het
Gbp8	T	C	5: 105,017,675		probably null	Het
Gcn1l1	T	A	5: 115,592,421	L888Q	probably damaging	Het
Gm17490	T	C	2: 11,625,649		probably benign	Het
Gtf2ird2	T	A	5: 134,208,944		probably null	Het
H2-Q1	A	G	17: 35,321,397	T153A	possibly damaging	Het
Ina	A	C	19: 47,023,499	E452A	probably benign	Het
Kars	A	G	8: 111,994,862		probably null	Het
Kif1c	A	G	11: 70,704,465	E124G	probably damaging	Het
Lpin3	T	C	2: 160,904,024		probably benign	Het
Lrp1	A	T	10: 127,555,009	C3006*	probably null	Het
Lyst	T	C	13: 13,709,386	L2953P	probably benign	Het
Mb21d2	G	A	16: 28,929,572	A31V	probably benign	Het
Melk	T	C	4: 44,308,906	Y88H	probably damaging	Het
Myrf	A	G	19: 10,211,797	S857P	probably damaging	Het
Nos2	A	G	11: 78,935,361	I153M	possibly damaging	Het
Olfr732	T	G	14: 50,281,913	L113F	probably benign	Het
Otof	A	G	5: 30,371,881		probably benign	Het
Patl2	A	G	2: 122,125,308	V249A	probably damaging	Het
Pcgf5	A	G	19: 36,412,180	Y19C	probably benign	Het
Pcnt	A	T	10: 76,412,107	V951E	probably damaging	Het
Pcolce2	T	C	9: 95,638,657	V29A	probably benign	Het
Pdgfrb	A	T	18: 61,077,703	M761L	probably benign	Het
Pi16	A	T	17: 29,319,215	M1L	possibly damaging	Het
Pkd2	T	A	5: 104,455,605		probably benign	Het
Plcb2	A	G	2: 118,717,325	W474R	probably benign	Het
Psapl1	A	G	5: 36,204,280	D72G	possibly damaging	Het
Ptpn5	T	A	7: 47,078,933		probably benign	Het
Ptprg	A	G	14: 12,215,896	E1115G	probably damaging	Het
Rassf1	C	T	9: 107,557,966	T224I	probably damaging	Het
Rbpms2	T	A	9: 65,659,194	C168*	probably null	Het
Rhag	A	G	17: 40,828,913		probably benign	Het
Rhebl1	C	T	15: 98,881,153	V17I	probably benign	Het
Rnf130	A	T	11: 50,095,876	D349V	possibly damaging	Het
Rprd1a	A	G	18: 24,509,895	L60P	probably damaging	Het
Rspry1	T	C	8: 94,629,792	I25T	probably damaging	Het
Ruvbl2	C	T	7: 45,422,197	V421M	probably damaging	Het
Sap30	T	C	8: 57,482,966	N209D	possibly damaging	Het
Sfswap	T	C	5: 129,503,978		probably benign	Het
Slc1a2	G	A	2: 102,756,007	V319M	probably damaging	Het
Smad2	T	C	18: 76,289,179		probably benign	Het
Spdya	T	C	17: 71,562,590		probably null	Het
Stk39	G	A	2: 68,410,048	T113M	probably damaging	Het
Tanc1	A	G	2: 59,796,038		probably benign	Het
Tas2r122	T	C	6: 132,711,811	K40E	probably damaging	Het
Tph2	G	T	10: 115,174,134		probably benign	Het
Trip12	G	A	1: 84,751,548	S1083F	probably damaging	Het
Tsc2	A	T	17: 24,626,727	C206S	probably damaging	Het
Tsc22d4	A	G	5: 137,762,419	Q34R	possibly damaging	Het
Uroc1	G	T	6: 90,338,564	M142I	possibly damaging	Het
Uso1	T	C	5: 92,199,823	S766P	probably benign	Het
Usp21	G	A	1: 171,283,746		probably benign	Het
Usp48	T	A	4: 137,633,126	I658K	possibly damaging	Het
Vmn1r206	T	C	13: 22,620,413	H208R	probably damaging	Het
Vmn2r109	C	T	17: 20,540,675	A807T	probably damaging	Het
Zfp329	A	T	7: 12,810,452	C382S	probably damaging	Het
Zfp341	A	G	2: 154,646,068	E817G	probably benign	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1498:Adamts5	UTSW	16	85900102	missense	possibly damaging	0.63
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1906:Adamts5	UTSW	16	85868685	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2180:Adamts5	UTSW	16	85887924	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4214:Adamts5	UTSW	16	85868643	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5230:Adamts5	UTSW	16	85870068	missense	probably damaging	0.97
R5452:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R5652:Adamts5	UTSW	16	85899268	missense	probably damaging	1.00
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6259:Adamts5	UTSW	16	85899753	missense	probably benign	0.03
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6724:Adamts5	UTSW	16	85868557	missense	probably benign	0.06
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7066:Adamts5	UTSW	16	85862764	missense	probably damaging	1.00
R7256:Adamts5	UTSW	16	85863035	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7298:Adamts5	UTSW	16	85899918	missense	probably benign	0.35
R7384:Adamts5	UTSW	16	85899826	missense	probably benign	0.02
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
R7727:Adamts5	UTSW	16	85899966	missense	probably damaging	1.00
R7785:Adamts5	UTSW	16	85863004	missense	probably damaging	0.99
R7894:Adamts5	UTSW	16	85877920	nonsense	probably null
R8111:Adamts5	UTSW	16	85899315	missense	probably damaging	1.00
R8370:Adamts5	UTSW	16	85899993	missense	possibly damaging	0.74
R8413:Adamts5	UTSW	16	85866618	critical splice donor site	probably null
R8505:Adamts5	UTSW	16	85900056	missense	probably benign	0.42
R8804:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R9209:Adamts5	UTSW	16	85870083	missense	probably damaging	1.00
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00
Z1177:Adamts5	UTSW	16	85870074	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTTATGGGAGAAGCAGAGCCAC -3'
(R):5'- TCAGCTTTCTCGCCATCTGGGAAC -3'

Sequencing Primer
(F):5'- CTAGCAAGACCTGCCCTTC -3'
(R):5'- GACCTCAGACTTGGTGGAG -3'

Posted On

2013-06-11