Mutagenetix > Incidental Mutations

Incidental Mutation 'R0570:Abca3'

46411

Institutional Source

Beutler Lab

Gene Symbol

Abca3

Ensembl Gene

ENSMUSG00000024130

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 3

Synonyms

ABC-C, 1810036E22Rik, Abc3

MMRRC Submission

038761-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0570 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24351950-24410201 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24374399 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 257 (I257V)

Ref Sequence

ENSEMBL: ENSMUSP00000078544 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039013] [ENSMUST00000079594] [ENSMUST00000117337]

Predicted Effect

probably benign
Transcript: ENSMUST00000039013
AA Change: I257V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000045285
Gene: ENSMUSG00000024130
AA Change: I257V

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	21	469	2.1e-29	PFAM
AAA	558	740	5.17e-10	SMART
Pfam:ABC2_membrane_3	923	1323	1.8e-35	PFAM
AAA	1408	1592	1.64e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000079594
AA Change: I257V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000078544
Gene: ENSMUSG00000024130
AA Change: I257V

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	22	469	2.6e-28	PFAM
AAA	558	740	5.17e-10	SMART
Pfam:ABC2_membrane_3	923	1323	5.5e-39	PFAM
AAA	1408	1592	1.64e-3	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000117337
AA Change: I257V

SMART Domains

Protein: ENSMUSP00000113538
Gene: ENSMUSG00000024130
AA Change: I257V

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	21	469	1.3e-29	PFAM
AAA	558	740	5.17e-10	SMART
Pfam:ABC2_membrane_3	761	1068	8.8e-29	PFAM
AAA	1153	1337	1.64e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133816

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136295

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149233

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 97.0%
20x: 94.3%

Validation Efficiency

100% (85/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality, respiratory failure, and severely impaired surfactant secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700067K01Rik	C	A	8: 84,003,104		probably benign	Het
Aadacl3	C	T	4: 144,463,560	W57*	probably null	Het
Abca2	G	T	2: 25,447,405		probably null	Het
Adamts2	A	G	11: 50,776,136	D420G	probably damaging	Het
Adamts5	A	G	16: 85,899,247	F341L	probably damaging	Het
Ahnak	T	A	19: 9,013,698	D4115E	probably damaging	Het
Arhgap20	T	C	9: 51,840,451	S365P	possibly damaging	Het
Atrn	G	A	2: 130,980,134	V916I	probably benign	Het
Blmh	T	C	11: 76,965,825	V82A	probably damaging	Het
C1ra	A	T	6: 124,513,705	Y19F	probably benign	Het
Cactin	A	G	10: 81,323,233	E306G	probably damaging	Het
Celsr1	C	T	15: 85,903,365	R2724Q	probably benign	Het
Clca4b	T	C	3: 144,925,349	E250G	probably benign	Het
Col17a1	A	T	19: 47,665,878	S647T	possibly damaging	Het
Cope	T	A	8: 70,306,531	D74E	probably damaging	Het
Dsg1c	T	C	18: 20,270,378	I198T	probably damaging	Het
Elfn2	T	C	15: 78,673,234	N371S	probably damaging	Het
Elmo2	G	T	2: 165,304,919	A246D	probably benign	Het
Ewsr1	A	T	11: 5,085,935	M187K	possibly damaging	Het
Faap100	A	T	11: 120,374,288	S587R	possibly damaging	Het
Fam234b	C	T	6: 135,209,249	S85L	probably benign	Het
Fanca	A	T	8: 123,306,430	S292R	probably benign	Het
Fanci	G	A	7: 79,443,963	C1021Y	probably damaging	Het
Fhod3	T	C	18: 25,112,583	I1230T	probably benign	Het
Fmo5	T	C	3: 97,629,140	L27S	probably damaging	Het
Fmo9	A	G	1: 166,674,462	V147A	probably null	Het
Fnbp4	A	G	2: 90,752,957	Y309C	probably damaging	Het
Foxb1	T	C	9: 69,759,562	T229A	probably benign	Het
Gapvd1	A	G	2: 34,728,540	Y274H	probably damaging	Het
Gbp8	T	C	5: 105,017,675		probably null	Het
Gcn1l1	T	A	5: 115,592,421	L888Q	probably damaging	Het
Gm17490	T	C	2: 11,625,649		probably benign	Het
Gtf2ird2	T	A	5: 134,208,944		probably null	Het
H2-Q1	A	G	17: 35,321,397	T153A	possibly damaging	Het
Ina	A	C	19: 47,023,499	E452A	probably benign	Het
Kars	A	G	8: 111,994,862		probably null	Het
Kif1c	A	G	11: 70,704,465	E124G	probably damaging	Het
Lpin3	T	C	2: 160,904,024		probably benign	Het
Lrp1	A	T	10: 127,555,009	C3006*	probably null	Het
Lyst	T	C	13: 13,709,386	L2953P	probably benign	Het
Mb21d2	G	A	16: 28,929,572	A31V	probably benign	Het
Melk	T	C	4: 44,308,906	Y88H	probably damaging	Het
Myrf	A	G	19: 10,211,797	S857P	probably damaging	Het
Nos2	A	G	11: 78,935,361	I153M	possibly damaging	Het
Olfr732	T	G	14: 50,281,913	L113F	probably benign	Het
Otof	A	G	5: 30,371,881		probably benign	Het
Patl2	A	G	2: 122,125,308	V249A	probably damaging	Het
Pcgf5	A	G	19: 36,412,180	Y19C	probably benign	Het
Pcnt	A	T	10: 76,412,107	V951E	probably damaging	Het
Pcolce2	T	C	9: 95,638,657	V29A	probably benign	Het
Pdgfrb	A	T	18: 61,077,703	M761L	probably benign	Het
Pi16	A	T	17: 29,319,215	M1L	possibly damaging	Het
Pkd2	T	A	5: 104,455,605		probably benign	Het
Plcb2	A	G	2: 118,717,325	W474R	probably benign	Het
Psapl1	A	G	5: 36,204,280	D72G	possibly damaging	Het
Ptpn5	T	A	7: 47,078,933		probably benign	Het
Ptprg	A	G	14: 12,215,896	E1115G	probably damaging	Het
Rassf1	C	T	9: 107,557,966	T224I	probably damaging	Het
Rbpms2	T	A	9: 65,659,194	C168*	probably null	Het
Rhag	A	G	17: 40,828,913		probably benign	Het
Rhebl1	C	T	15: 98,881,153	V17I	probably benign	Het
Rnf130	A	T	11: 50,095,876	D349V	possibly damaging	Het
Rprd1a	A	G	18: 24,509,895	L60P	probably damaging	Het
Rspry1	T	C	8: 94,629,792	I25T	probably damaging	Het
Ruvbl2	C	T	7: 45,422,197	V421M	probably damaging	Het
Sap30	T	C	8: 57,482,966	N209D	possibly damaging	Het
Sfswap	T	C	5: 129,503,978		probably benign	Het
Slc1a2	G	A	2: 102,756,007	V319M	probably damaging	Het
Smad2	T	C	18: 76,289,179		probably benign	Het
Spdya	T	C	17: 71,562,590		probably null	Het
Stk39	G	A	2: 68,410,048	T113M	probably damaging	Het
Tanc1	A	G	2: 59,796,038		probably benign	Het
Tas2r122	T	C	6: 132,711,811	K40E	probably damaging	Het
Tph2	G	T	10: 115,174,134		probably benign	Het
Trip12	G	A	1: 84,751,548	S1083F	probably damaging	Het
Tsc2	A	T	17: 24,626,727	C206S	probably damaging	Het
Tsc22d4	A	G	5: 137,762,419	Q34R	possibly damaging	Het
Uroc1	G	T	6: 90,338,564	M142I	possibly damaging	Het
Uso1	T	C	5: 92,199,823	S766P	probably benign	Het
Usp21	G	A	1: 171,283,746		probably benign	Het
Usp48	T	A	4: 137,633,126	I658K	possibly damaging	Het
Vmn1r206	T	C	13: 22,620,413	H208R	probably damaging	Het
Vmn2r109	C	T	17: 20,540,675	A807T	probably damaging	Het
Zfp329	A	T	7: 12,810,452	C382S	probably damaging	Het
Zfp341	A	G	2: 154,646,068	E817G	probably benign	Het

Other mutations in Abca3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Abca3	APN	17	24374246	missense	probably damaging	1.00
IGL01538:Abca3	APN	17	24376473	missense	possibly damaging	0.64
IGL01633:Abca3	APN	17	24397353	nonsense	probably null
IGL01837:Abca3	APN	17	24408697	missense	probably damaging	1.00
IGL01986:Abca3	APN	17	24408114	missense	probably damaging	1.00
IGL02049:Abca3	APN	17	24376730	nonsense	probably null
IGL02186:Abca3	APN	17	24377740	missense	possibly damaging	0.95
IGL02794:Abca3	APN	17	24402411	missense	probably benign	0.05
IGL02962:Abca3	APN	17	24400409	missense	probably damaging	1.00
IGL02963:Abca3	APN	17	24384529	missense	probably damaging	1.00
IGL03118:Abca3	APN	17	24400450	missense	probably benign	0.17
IGL03144:Abca3	APN	17	24381964	missense	probably benign	0.37
R0028:Abca3	UTSW	17	24377724	missense	probably benign	0.39
R0278:Abca3	UTSW	17	24381920	missense	probably benign	0.09
R0825:Abca3	UTSW	17	24400577	missense	probably damaging	1.00
R1164:Abca3	UTSW	17	24402331	missense	probably damaging	1.00
R1348:Abca3	UTSW	17	24374238	splice site	probably null
R1557:Abca3	UTSW	17	24399980	missense	possibly damaging	0.46
R1661:Abca3	UTSW	17	24377842	missense	probably damaging	0.99
R1665:Abca3	UTSW	17	24377842	missense	probably damaging	0.99
R1754:Abca3	UTSW	17	24377779	missense	probably benign	0.00
R1828:Abca3	UTSW	17	24366197	missense	probably benign	0.34
R1834:Abca3	UTSW	17	24376692	missense	probably benign	0.00
R1996:Abca3	UTSW	17	24387532	missense	probably damaging	1.00
R2032:Abca3	UTSW	17	24366082	splice site	probably benign
R2100:Abca3	UTSW	17	24408209	missense	probably damaging	0.99
R2154:Abca3	UTSW	17	24377719	missense	probably damaging	1.00
R2240:Abca3	UTSW	17	24376443	missense	probably damaging	0.98
R2281:Abca3	UTSW	17	24376726	missense	possibly damaging	0.88
R2994:Abca3	UTSW	17	24384564	missense	probably damaging	1.00
R4091:Abca3	UTSW	17	24397482	missense	probably damaging	1.00
R4294:Abca3	UTSW	17	24400569	missense	possibly damaging	0.96
R4496:Abca3	UTSW	17	24383973	missense	possibly damaging	0.93
R4633:Abca3	UTSW	17	24387529	missense	probably null	1.00
R4866:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5022:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5023:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5072:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5073:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5074:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5123:Abca3	UTSW	17	24384460	missense	possibly damaging	0.95
R5157:Abca3	UTSW	17	24408122	missense	probably damaging	1.00
R5183:Abca3	UTSW	17	24374453	missense	probably benign	0.39
R5269:Abca3	UTSW	17	24376743	missense	possibly damaging	0.95
R5566:Abca3	UTSW	17	24383927	missense	probably benign
R5579:Abca3	UTSW	17	24376729	missense	probably damaging	0.97
R5620:Abca3	UTSW	17	24396470	missense	probably benign	0.05
R5755:Abca3	UTSW	17	24398454	missense	probably damaging	1.00
R5954:Abca3	UTSW	17	24397416	missense	probably benign	0.00
R6041:Abca3	UTSW	17	24376380	missense	probably damaging	0.99
R6187:Abca3	UTSW	17	24408167	missense	possibly damaging	0.88
R6253:Abca3	UTSW	17	24397552	missense	probably benign	0.01
R6375:Abca3	UTSW	17	24387562	missense	possibly damaging	0.96
R6487:Abca3	UTSW	17	24397472	missense	possibly damaging	0.81
R6616:Abca3	UTSW	17	24384535	missense	probably damaging	1.00
R6632:Abca3	UTSW	17	24384470	missense	probably benign
R6781:Abca3	UTSW	17	24374406	missense	possibly damaging	0.95
R6918:Abca3	UTSW	17	24408658	missense	probably damaging	1.00
R6962:Abca3	UTSW	17	24364726	missense	probably benign	0.39
R7163:Abca3	UTSW	17	24364942	missense	probably benign
R7199:Abca3	UTSW	17	24377707	missense	probably damaging	1.00
R7287:Abca3	UTSW	17	24385887	missense	possibly damaging	0.91
R7303:Abca3	UTSW	17	24398521	missense	possibly damaging	0.83
R7338:Abca3	UTSW	17	24376743	missense	possibly damaging	0.95
R7430:Abca3	UTSW	17	24364958	critical splice donor site	probably null
R7437:Abca3	UTSW	17	24400498	missense	probably damaging	0.99
R7776:Abca3	UTSW	17	24386276	missense	possibly damaging	0.77
R7805:Abca3	UTSW	17	24405154	critical splice donor site	probably null
R7811:Abca3	UTSW	17	24397388	missense	probably benign	0.00
R7848:Abca3	UTSW	17	24384532	missense	probably damaging	1.00
R7859:Abca3	UTSW	17	24384526	missense	probably damaging	1.00
R7877:Abca3	UTSW	17	24384023	nonsense	probably null
R7893:Abca3	UTSW	17	24385466	missense	probably damaging	1.00
R7910:Abca3	UTSW	17	24385853	missense	probably benign	0.09
R7911:Abca3	UTSW	17	24398504	missense	probably damaging	1.00
R7964:Abca3	UTSW	17	24402436	missense	probably benign	0.26
R8016:Abca3	UTSW	17	24364952	missense	probably benign	0.06
R8028:Abca3	UTSW	17	24407697	missense	probably benign	0.02
R8150:Abca3	UTSW	17	24396548	missense	probably benign	0.08
R8298:Abca3	UTSW	17	24385401	missense	probably damaging	1.00
R8444:Abca3	UTSW	17	24383985	missense	probably damaging	0.98
R8505:Abca3	UTSW	17	24374497	missense	probably damaging	0.97
R8547:Abca3	UTSW	17	24397500	missense	probably benign	0.00
X0018:Abca3	UTSW	17	24396480	missense	possibly damaging	0.63
Z1177:Abca3	UTSW	17	24408236	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GAACTCAGGATACATTCGGGAAGGC -3'
(R):5'- GGACTTCCTAACCTTGTGTCACAGC -3'

Sequencing Primer
(F):5'- CCAGAAGCTCATGGTGATCA -3'
(R):5'- TTATGGTCCCAGCACACAGG -3'

Posted On

2013-06-11