Incidental Mutation 'R0571:Ghsr'
ID46437
Institutional Source Beutler Lab
Gene Symbol Ghsr
Ensembl Gene ENSMUSG00000051136
Gene Namegrowth hormone secretagogue receptor
SynonymsC530020I22Rik
MMRRC Submission 038762-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0571 (G1)
Quality Score187
Status Validated
Chromosome3
Chromosomal Location27371351-27378010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27372016 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 74 (R74C)
Ref Sequence ENSEMBL: ENSMUSP00000061153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057186]
Predicted Effect probably damaging
Transcript: ENSMUST00000057186
AA Change: R74C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061153
Gene: ENSMUSG00000051136
AA Change: R74C

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
Pfam:7TM_GPCR_Srw 47 339 5.8e-12 PFAM
Pfam:7TM_GPCR_Srsx 53 336 9.4e-8 PFAM
Pfam:7tm_1 59 321 7.9e-51 PFAM
Pfam:7TM_GPCR_Srv 61 338 4.8e-9 PFAM
Meta Mutation Damage Score 0.8964 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor family. The encoded protein may play a role in energy homeostasis and regulation of body weight. Two identified transcript variants are expressed in several tissues and are evolutionary conserved in fish and swine. One transcript, 1a, excises an intron and encodes the functional protein; this protein is the receptor for the Ghrelin ligand and defines a neuroendocrine pathway for growth hormone release. The second transcript (1b) retains the intron and does not function as a receptor for Ghrelin; however, it may function to attenuate activity of isoform 1a. Mutations in this gene are associated with autosomal idiopathic short stature.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homeostasis is disrupted by inactivation of this gene, namely growth hormone release and appetite stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,259,793 D2909G unknown Het
Abhd4 C T 14: 54,263,249 T165I possibly damaging Het
Acsl5 A G 19: 55,288,911 probably benign Het
Actl6b C A 5: 137,566,784 probably benign Het
Atg13 T C 2: 91,678,718 probably benign Het
Cabyr A G 18: 12,750,852 E132G probably damaging Het
Cadps2 C T 6: 23,583,412 V389I probably damaging Het
Capn2 C T 1: 182,470,760 V647I probably benign Het
Card10 G T 15: 78,787,401 P621Q possibly damaging Het
Catsperb C G 12: 101,602,774 H902D possibly damaging Het
Cers3 A G 7: 66,786,057 M255V possibly damaging Het
Cfh T C 1: 140,102,333 probably null Het
Chd3 A C 11: 69,361,669 probably null Het
Chpf2 G T 5: 24,590,427 R316L probably damaging Het
Clca1 T A 3: 145,007,789 N694Y probably damaging Het
Ctbp2 G A 7: 133,014,805 L44F probably damaging Het
Cttnbp2 T C 6: 18,381,103 M1365V probably benign Het
D130052B06Rik G A 11: 33,623,922 R173H probably benign Het
Dchs1 A G 7: 105,771,996 F406L probably damaging Het
Ddx43 T A 9: 78,413,863 N384K possibly damaging Het
Drd5 G A 5: 38,319,927 V88M probably damaging Het
Eefsec A T 6: 88,297,899 F361Y probably benign Het
Epb41 T C 4: 131,989,904 D313G probably damaging Het
Etl4 T C 2: 20,743,769 M104T probably damaging Het
Fabp7 A T 10: 57,785,541 T37S probably benign Het
Fam186b T C 15: 99,286,953 T30A probably benign Het
Fam83d G A 2: 158,785,691 W433* probably null Het
Fmnl2 A T 2: 53,054,491 T161S probably benign Het
Gm6990 G A 19: 56,755,243 noncoding transcript Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Gtpbp4 A T 13: 8,990,686 probably benign Het
Hamp2 A G 7: 30,924,086 L17P possibly damaging Het
Heatr1 C A 13: 12,430,240 S1581R probably damaging Het
Hpf1 T C 8: 60,900,113 V176A probably benign Het
Hydin T A 8: 110,514,103 probably null Het
Ighg2c G A 12: 113,288,762 Q57* probably null Het
Itgb4 A G 11: 115,979,768 N141S possibly damaging Het
Kif13b G T 14: 64,751,528 R786L probably damaging Het
Lhx3 C A 2: 26,201,124 W391L probably damaging Het
Map1s T A 8: 70,912,907 V152D probably damaging Het
Map4 T C 9: 110,036,766 M608T probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mfn1 T C 3: 32,561,472 I328T probably damaging Het
Myh4 A T 11: 67,250,331 I740F possibly damaging Het
Neo1 A G 9: 58,985,786 V191A probably benign Het
Nfatc4 T C 14: 55,830,028 V565A probably damaging Het
Nrxn2 G C 19: 6,473,533 E525D probably damaging Het
Olfr361 T C 2: 37,085,334 H138R probably benign Het
Pcdhb12 A T 18: 37,437,208 D469V probably damaging Het
Pcdhb6 G T 18: 37,335,114 V363L probably benign Het
Pkd1l2 T C 8: 117,082,218 T78A probably benign Het
Primpol T G 8: 46,581,639 D418A probably damaging Het
Rbm12b1 G A 4: 12,146,248 S740N probably benign Het
Rpe65 T C 3: 159,600,349 L15P probably damaging Het
Rxrb CGCGGCGGCGGCGGCGGCGGC CGCGGCGGCGGCGGCGGC 17: 34,032,132 probably benign Het
Sectm1a A G 11: 121,069,102 probably benign Het
Sft2d1 C A 17: 8,326,950 probably benign Het
Slc22a18 A G 7: 143,491,861 probably benign Het
Slu7 G A 11: 43,441,578 probably null Het
Smc4 T C 3: 69,024,289 V572A probably damaging Het
Spire2 T A 8: 123,354,116 I33N probably damaging Het
Tbck T A 3: 132,752,642 C678S probably damaging Het
Tnrc6b T C 15: 80,913,338 V1362A probably damaging Het
Ttn T C 2: 76,739,982 K25110E possibly damaging Het
Ugt2b35 A G 5: 87,000,934 S15G possibly damaging Het
Upf3a T A 8: 13,792,184 I200K probably damaging Het
Vill G C 9: 119,070,633 G295A possibly damaging Het
Vmn1r191 A T 13: 22,179,047 V179D probably damaging Het
Vmn2r74 T C 7: 85,952,421 T670A probably damaging Het
Zfp169 T C 13: 48,489,690 T654A possibly damaging Het
Zfp646 A G 7: 127,881,966 E1105G probably damaging Het
Zyg11b A T 4: 108,260,042 Y334N probably damaging Het
Other mutations in Ghsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ghsr APN 3 27374873 missense possibly damaging 0.92
IGL00435:Ghsr APN 3 27372383 missense possibly damaging 0.91
IGL01376:Ghsr APN 3 27371828 missense probably benign
IGL02444:Ghsr APN 3 27372040 missense probably benign 0.17
IGL02650:Ghsr APN 3 27374855 missense probably benign 0.29
IGL02754:Ghsr APN 3 27372496 missense probably damaging 1.00
R0825:Ghsr UTSW 3 27374627 missense probably damaging 0.99
R1036:Ghsr UTSW 3 27374720 missense probably damaging 0.98
R1462:Ghsr UTSW 3 27371876 missense probably benign 0.01
R1462:Ghsr UTSW 3 27371876 missense probably benign 0.01
R1529:Ghsr UTSW 3 27372482 missense probably damaging 1.00
R1598:Ghsr UTSW 3 27372277 missense probably benign 0.27
R4846:Ghsr UTSW 3 27371837 missense probably benign
R4951:Ghsr UTSW 3 27372361 missense possibly damaging 0.83
R4993:Ghsr UTSW 3 27372254 missense possibly damaging 0.87
R5055:Ghsr UTSW 3 27372272 missense probably benign 0.28
R6843:Ghsr UTSW 3 27372527 missense probably benign
R6936:Ghsr UTSW 3 27372325 missense probably benign 0.02
R7068:Ghsr UTSW 3 27371837 missense probably benign 0.01
R7318:Ghsr UTSW 3 27372467 missense possibly damaging 0.91
R7510:Ghsr UTSW 3 27372374 missense probably benign 0.05
R7889:Ghsr UTSW 3 27372166 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCCTGGCAACATGTGGAACG -3'
(R):5'- TGACAAGGATGACCAGCTTCACAC -3'

Sequencing Primer
(F):5'- TAACGTCACGCTGGACCTG -3'
(R):5'- TTGGTGACCACCACCTTGG -3'
Posted On2013-06-11