Mutagenetix > Incidental Mutation

Incidental Mutation 'R0571:Rpe65'

46442

Institutional Source

Beutler Lab

Gene Symbol

Rpe65

Ensembl Gene

ENSMUSG00000028174

Gene Name

retinal pigment epithelium 65

Synonyms

A930029L06Rik, Mord1, rd12

MMRRC Submission

038762-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.191) question?

Stock #

R0571 (G1)

Quality Score

221

Status

Validated

Chromosome

Chromosomal Location

159599175-159625321 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 159600349 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 15 (L15P)

Ref Sequence

ENSEMBL: ENSMUSP00000143390 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999] [ENSMUST00000197771]

AlphaFold

Q91ZQ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000029824
AA Change: L15P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: L15P

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000196999
AA Change: L15P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: L15P

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000197771
AA Change: L15P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143390
Gene: ENSMUSG00000028174
AA Change: L15P

Domain	Start	End	E-Value	Type
Pfam:RPE65	13	109	5.8e-19	PFAM

Meta Mutation Damage Score

0.7833

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.9%
20x: 94.7%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	G	15: 8,259,793	D2909G	unknown	Het
Abhd4	C	T	14: 54,263,249	T165I	possibly damaging	Het
Acsl5	A	G	19: 55,288,911		probably benign	Het
Actl6b	C	A	5: 137,566,784		probably benign	Het
Atg13	T	C	2: 91,678,718		probably benign	Het
Cabyr	A	G	18: 12,750,852	E132G	probably damaging	Het
Cadps2	C	T	6: 23,583,412	V389I	probably damaging	Het
Capn2	C	T	1: 182,470,760	V647I	probably benign	Het
Card10	G	T	15: 78,787,401	P621Q	possibly damaging	Het
Catsperb	C	G	12: 101,602,774	H902D	possibly damaging	Het
Cers3	A	G	7: 66,786,057	M255V	possibly damaging	Het
Cfh	T	C	1: 140,102,333		probably null	Het
Chd3	A	C	11: 69,361,669		probably null	Het
Chpf2	G	T	5: 24,590,427	R316L	probably damaging	Het
Clca1	T	A	3: 145,007,789	N694Y	probably damaging	Het
Ctbp2	G	A	7: 133,014,805	L44F	probably damaging	Het
Cttnbp2	T	C	6: 18,381,103	M1365V	probably benign	Het
D130052B06Rik	G	A	11: 33,623,922	R173H	probably benign	Het
Dchs1	A	G	7: 105,771,996	F406L	probably damaging	Het
Ddx43	T	A	9: 78,413,863	N384K	possibly damaging	Het
Drd5	G	A	5: 38,319,927	V88M	probably damaging	Het
Eefsec	A	T	6: 88,297,899	F361Y	probably benign	Het
Epb41	T	C	4: 131,989,904	D313G	probably damaging	Het
Etl4	T	C	2: 20,743,769	M104T	probably damaging	Het
Fabp7	A	T	10: 57,785,541	T37S	probably benign	Het
Fam186b	T	C	15: 99,286,953	T30A	probably benign	Het
Fam83d	G	A	2: 158,785,691	W433*	probably null	Het
Fmnl2	A	T	2: 53,054,491	T161S	probably benign	Het
Ghsr	C	T	3: 27,372,016	R74C	probably damaging	Het
Gm6990	G	A	19: 56,755,243		noncoding transcript	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Gtpbp4	A	T	13: 8,990,686		probably benign	Het
Hamp2	A	G	7: 30,924,086	L17P	possibly damaging	Het
Heatr1	C	A	13: 12,430,240	S1581R	probably damaging	Het
Hpf1	T	C	8: 60,900,113	V176A	probably benign	Het
Hydin	T	A	8: 110,514,103		probably null	Het
Ighg2c	G	A	12: 113,288,762	Q57*	probably null	Het
Itgb4	A	G	11: 115,979,768	N141S	possibly damaging	Het
Kif13b	G	T	14: 64,751,528	R786L	probably damaging	Het
Lhx3	C	A	2: 26,201,124	W391L	probably damaging	Het
Map1s	T	A	8: 70,912,907	V152D	probably damaging	Het
Map4	T	C	9: 110,036,766	M608T	probably benign	Het
Mb21d2	G	A	16: 28,929,572	A31V	probably benign	Het
Mfn1	T	C	3: 32,561,472	I328T	probably damaging	Het
Myh4	A	T	11: 67,250,331	I740F	possibly damaging	Het
Neo1	A	G	9: 58,985,786	V191A	probably benign	Het
Nfatc4	T	C	14: 55,830,028	V565A	probably damaging	Het
Nrxn2	G	C	19: 6,473,533	E525D	probably damaging	Het
Olfr361	T	C	2: 37,085,334	H138R	probably benign	Het
Pcdhb12	A	T	18: 37,437,208	D469V	probably damaging	Het
Pcdhb6	G	T	18: 37,335,114	V363L	probably benign	Het
Pkd1l2	T	C	8: 117,082,218	T78A	probably benign	Het
Primpol	T	G	8: 46,581,639	D418A	probably damaging	Het
Rbm12b1	G	A	4: 12,146,248	S740N	probably benign	Het
Rxrb	CGCGGCGGCGGCGGCGGCGGC	CGCGGCGGCGGCGGCGGC	17: 34,032,132		probably benign	Het
Sectm1a	A	G	11: 121,069,102		probably benign	Het
Sft2d1	C	A	17: 8,326,950		probably benign	Het
Slc22a18	A	G	7: 143,491,861		probably benign	Het
Slu7	G	A	11: 43,441,578		probably null	Het
Smc4	T	C	3: 69,024,289	V572A	probably damaging	Het
Spire2	T	A	8: 123,354,116	I33N	probably damaging	Het
Tbck	T	A	3: 132,752,642	C678S	probably damaging	Het
Tnrc6b	T	C	15: 80,913,338	V1362A	probably damaging	Het
Ttn	T	C	2: 76,739,982	K25110E	possibly damaging	Het
Ugt2b35	A	G	5: 87,000,934	S15G	possibly damaging	Het
Upf3a	T	A	8: 13,792,184	I200K	probably damaging	Het
Vill	G	C	9: 119,070,633	G295A	possibly damaging	Het
Vmn1r191	A	T	13: 22,179,047	V179D	probably damaging	Het
Vmn2r74	T	C	7: 85,952,421	T670A	probably damaging	Het
Zfp169	T	C	13: 48,489,690	T654A	possibly damaging	Het
Zfp646	A	G	7: 127,881,966	E1105G	probably damaging	Het
Zyg11b	A	T	4: 108,260,042	Y334N	probably damaging	Het

Other mutations in Rpe65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Rpe65	APN	3	159614542	missense	probably damaging	0.99
IGL01446:Rpe65	APN	3	159600405	splice site	probably benign
IGL01815:Rpe65	APN	3	159604530	splice site	probably null
IGL02085:Rpe65	APN	3	159615646	missense	probably benign	0.00
IGL02232:Rpe65	APN	3	159604351	missense	possibly damaging	0.93
IGL02248:Rpe65	APN	3	159624705	missense	probably damaging	1.00
IGL02645:Rpe65	APN	3	159606491	missense	probably damaging	0.99
IGL02711:Rpe65	APN	3	159622877	missense	possibly damaging	0.84
IGL02982:Rpe65	APN	3	159600361	missense	probably damaging	0.99
IGL03280:Rpe65	APN	3	159604341	missense	probably damaging	0.96
IGL03350:Rpe65	APN	3	159614517	missense	possibly damaging	0.75
IGL03356:Rpe65	APN	3	159615577	missense	possibly damaging	0.89
I1329:Rpe65	UTSW	3	159624723	missense	probably benign	0.35
R0905:Rpe65	UTSW	3	159601583	missense	possibly damaging	0.95
R1024:Rpe65	UTSW	3	159606485	missense	probably benign	0.07
R1597:Rpe65	UTSW	3	159614784	missense	probably damaging	0.97
R1657:Rpe65	UTSW	3	159614448	missense	probably damaging	0.97
R1778:Rpe65	UTSW	3	159622848	missense	probably damaging	1.00
R1970:Rpe65	UTSW	3	159615670	missense	probably benign
R2259:Rpe65	UTSW	3	159615571	missense	probably damaging	1.00
R3012:Rpe65	UTSW	3	159604563	missense	possibly damaging	0.61
R3923:Rpe65	UTSW	3	159604400	missense	probably benign	0.16
R3975:Rpe65	UTSW	3	159604585	missense	probably damaging	1.00
R4204:Rpe65	UTSW	3	159604410	missense	probably damaging	0.99
R4825:Rpe65	UTSW	3	159624681	missense	probably benign
R4924:Rpe65	UTSW	3	159622631	missense	probably benign	0.01
R5269:Rpe65	UTSW	3	159604347	missense	probably benign	0.07
R5324:Rpe65	UTSW	3	159604404	missense	possibly damaging	0.94
R5441:Rpe65	UTSW	3	159604401	missense	probably damaging	1.00
R5854:Rpe65	UTSW	3	159615676	missense	probably benign
R5907:Rpe65	UTSW	3	159615682	critical splice donor site	probably null
R6149:Rpe65	UTSW	3	159614143	missense	probably benign
R6660:Rpe65	UTSW	3	159614708	missense	probably damaging	0.98
R6830:Rpe65	UTSW	3	159614168	missense	probably benign	0.06
R7025:Rpe65	UTSW	3	159622685	missense	probably damaging	1.00
R7092:Rpe65	UTSW	3	159615591	missense	probably damaging	1.00
R7203:Rpe65	UTSW	3	159622854	missense	probably damaging	0.99
R7366:Rpe65	UTSW	3	159624729	missense	probably benign	0.13
R7537:Rpe65	UTSW	3	159604609	missense	probably damaging	0.98
R7679:Rpe65	UTSW	3	159604393	missense	probably damaging	1.00
R8044:Rpe65	UTSW	3	159614705	missense	probably benign
R8179:Rpe65	UTSW	3	159624699	missense	probably benign	0.06
R8409:Rpe65	UTSW	3	159614148	missense	probably benign	0.01
R8558:Rpe65	UTSW	3	159614792	missense	probably damaging	1.00
R9042:Rpe65	UTSW	3	159615655	missense	probably damaging	1.00
R9483:Rpe65	UTSW	3	159622681	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTGAGCAACACCTCATGAAGTC -3'
(R):5'- ATTTGCCCAACTGCTGACATTTCAC -3'

Sequencing Primer
(F):5'- CACCTCATGAAGTCCTAAGTGG -3'
(R):5'- GATGATACTAACAGTGGCTCCTGTC -3'

Posted On

2013-06-11