Incidental Mutation 'R0571:Epb41'
ID46445
Institutional Source Beutler Lab
Gene Symbol Epb41
Ensembl Gene ENSMUSG00000028906
Gene Nameerythrocyte membrane protein band 4.1
SynonymsEpb4.1, 4.1R, D4Ertd442e, Elp1, Elp-1
MMRRC Submission 038762-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0571 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location131923413-132075321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131989904 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 313 (D313G)
Ref Sequence ENSEMBL: ENSMUSP00000120236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030739] [ENSMUST00000054917] [ENSMUST00000084253] [ENSMUST00000105970] [ENSMUST00000105972] [ENSMUST00000105974] [ENSMUST00000105975] [ENSMUST00000105981] [ENSMUST00000137846] [ENSMUST00000141291]
Predicted Effect probably damaging
Transcript: ENSMUST00000030739
AA Change: D313G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030739
Gene: ENSMUSG00000028906
AA Change: D313G

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054917
AA Change: D313G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060375
Gene: ENSMUSG00000028906
AA Change: D313G

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
Pfam:SAB 607 655 2.3e-28 PFAM
Pfam:4_1_CTD 687 801 3.2e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084253
AA Change: D313G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081274
Gene: ENSMUSG00000028906
AA Change: D313G

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
Pfam:SAB 607 655 2.3e-28 PFAM
Pfam:4_1_CTD 687 801 3.2e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105970
AA Change: D161G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101590
Gene: ENSMUSG00000028906
AA Change: D161G

DomainStartEndE-ValueType
B41 55 250 1.3e-80 SMART
FERM_C 254 344 1.01e-35 SMART
FA 347 393 8.99e-19 SMART
low complexity region 437 459 N/A INTRINSIC
Pfam:SAB 476 524 1.1e-29 PFAM
Pfam:4_1_CTD 578 636 1.4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105972
AA Change: D313G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101592
Gene: ENSMUSG00000028906
AA Change: D313G

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105974
AA Change: D278G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101594
Gene: ENSMUSG00000028906
AA Change: D278G

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 367 3.77e-50 SMART
FERM_C 371 461 1.01e-35 SMART
FA 464 510 8.99e-19 SMART
Pfam:SAB 572 620 2e-28 PFAM
Pfam:4_1_CTD 652 766 3e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105975
AA Change: D338G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101595
Gene: ENSMUSG00000028906
AA Change: D338G

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 232 427 1.3e-80 SMART
FERM_C 431 521 1.01e-35 SMART
FA 524 570 8.99e-19 SMART
low complexity region 619 632 N/A INTRINSIC
Pfam:SAB 672 720 3.9e-25 PFAM
Pfam:4_1_CTD 758 865 2.6e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105981
AA Change: D313G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101601
Gene: ENSMUSG00000028906
AA Change: D313G

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136761
Predicted Effect probably damaging
Transcript: ENSMUST00000137846
AA Change: D155G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123623
Gene: ENSMUSG00000028906
AA Change: D155G

DomainStartEndE-ValueType
B41 49 244 1.3e-80 SMART
FERM_C 248 338 1.01e-35 SMART
FA 341 387 8.99e-19 SMART
low complexity region 431 453 N/A INTRINSIC
Pfam:SAB 470 518 1.2e-29 PFAM
Pfam:4_1_CTD 550 664 2.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141291
AA Change: D313G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120236
Gene: ENSMUSG00000028906
AA Change: D313G

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 647 695 1.3e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144754
Predicted Effect unknown
Transcript: ENSMUST00000212761
AA Change: D35G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146021
Meta Mutation Damage Score 0.9657 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with spectrin and actin, constitute the red cell membrane cytoskeletal network. This complex plays a critical role in erythrocyte shape and deformability. Mutations in this gene are associated with type 1 elliptocytosis (EL1). Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit moderate hemolytic anemia, erythrocytic abnormalities including aberrant morphology, reduced membrane stability, and lowered expression of spectrin and ankyrin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,259,793 D2909G unknown Het
Abhd4 C T 14: 54,263,249 T165I possibly damaging Het
Acsl5 A G 19: 55,288,911 probably benign Het
Actl6b C A 5: 137,566,784 probably benign Het
Atg13 T C 2: 91,678,718 probably benign Het
Cabyr A G 18: 12,750,852 E132G probably damaging Het
Cadps2 C T 6: 23,583,412 V389I probably damaging Het
Capn2 C T 1: 182,470,760 V647I probably benign Het
Card10 G T 15: 78,787,401 P621Q possibly damaging Het
Catsperb C G 12: 101,602,774 H902D possibly damaging Het
Cers3 A G 7: 66,786,057 M255V possibly damaging Het
Cfh T C 1: 140,102,333 probably null Het
Chd3 A C 11: 69,361,669 probably null Het
Chpf2 G T 5: 24,590,427 R316L probably damaging Het
Clca1 T A 3: 145,007,789 N694Y probably damaging Het
Ctbp2 G A 7: 133,014,805 L44F probably damaging Het
Cttnbp2 T C 6: 18,381,103 M1365V probably benign Het
D130052B06Rik G A 11: 33,623,922 R173H probably benign Het
Dchs1 A G 7: 105,771,996 F406L probably damaging Het
Ddx43 T A 9: 78,413,863 N384K possibly damaging Het
Drd5 G A 5: 38,319,927 V88M probably damaging Het
Eefsec A T 6: 88,297,899 F361Y probably benign Het
Etl4 T C 2: 20,743,769 M104T probably damaging Het
Fabp7 A T 10: 57,785,541 T37S probably benign Het
Fam186b T C 15: 99,286,953 T30A probably benign Het
Fam83d G A 2: 158,785,691 W433* probably null Het
Fmnl2 A T 2: 53,054,491 T161S probably benign Het
Ghsr C T 3: 27,372,016 R74C probably damaging Het
Gm6990 G A 19: 56,755,243 noncoding transcript Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Gtpbp4 A T 13: 8,990,686 probably benign Het
Hamp2 A G 7: 30,924,086 L17P possibly damaging Het
Heatr1 C A 13: 12,430,240 S1581R probably damaging Het
Hpf1 T C 8: 60,900,113 V176A probably benign Het
Hydin T A 8: 110,514,103 probably null Het
Ighg2c G A 12: 113,288,762 Q57* probably null Het
Itgb4 A G 11: 115,979,768 N141S possibly damaging Het
Kif13b G T 14: 64,751,528 R786L probably damaging Het
Lhx3 C A 2: 26,201,124 W391L probably damaging Het
Map1s T A 8: 70,912,907 V152D probably damaging Het
Map4 T C 9: 110,036,766 M608T probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mfn1 T C 3: 32,561,472 I328T probably damaging Het
Myh4 A T 11: 67,250,331 I740F possibly damaging Het
Neo1 A G 9: 58,985,786 V191A probably benign Het
Nfatc4 T C 14: 55,830,028 V565A probably damaging Het
Nrxn2 G C 19: 6,473,533 E525D probably damaging Het
Olfr361 T C 2: 37,085,334 H138R probably benign Het
Pcdhb12 A T 18: 37,437,208 D469V probably damaging Het
Pcdhb6 G T 18: 37,335,114 V363L probably benign Het
Pkd1l2 T C 8: 117,082,218 T78A probably benign Het
Primpol T G 8: 46,581,639 D418A probably damaging Het
Rbm12b1 G A 4: 12,146,248 S740N probably benign Het
Rpe65 T C 3: 159,600,349 L15P probably damaging Het
Rxrb CGCGGCGGCGGCGGCGGCGGC CGCGGCGGCGGCGGCGGC 17: 34,032,132 probably benign Het
Sectm1a A G 11: 121,069,102 probably benign Het
Sft2d1 C A 17: 8,326,950 probably benign Het
Slc22a18 A G 7: 143,491,861 probably benign Het
Slu7 G A 11: 43,441,578 probably null Het
Smc4 T C 3: 69,024,289 V572A probably damaging Het
Spire2 T A 8: 123,354,116 I33N probably damaging Het
Tbck T A 3: 132,752,642 C678S probably damaging Het
Tnrc6b T C 15: 80,913,338 V1362A probably damaging Het
Ttn T C 2: 76,739,982 K25110E possibly damaging Het
Ugt2b35 A G 5: 87,000,934 S15G possibly damaging Het
Upf3a T A 8: 13,792,184 I200K probably damaging Het
Vill G C 9: 119,070,633 G295A possibly damaging Het
Vmn1r191 A T 13: 22,179,047 V179D probably damaging Het
Vmn2r74 T C 7: 85,952,421 T670A probably damaging Het
Zfp169 T C 13: 48,489,690 T654A possibly damaging Het
Zfp646 A G 7: 127,881,966 E1105G probably damaging Het
Zyg11b A T 4: 108,260,042 Y334N probably damaging Het
Other mutations in Epb41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Epb41 APN 4 131974731 missense probably benign
IGL00897:Epb41 APN 4 132000197 splice site probably null
IGL00911:Epb41 APN 4 131989784 missense possibly damaging 0.60
IGL01390:Epb41 APN 4 132003737 missense probably benign
IGL01459:Epb41 APN 4 131964128 intron probably benign
IGL01816:Epb41 APN 4 132003695 missense probably benign 0.00
IGL02192:Epb41 APN 4 131929717 missense probably damaging 0.99
IGL02296:Epb41 APN 4 132003754 missense probably benign 0.42
IGL03011:Epb41 APN 4 132003794 missense probably damaging 1.00
IGL03268:Epb41 APN 4 131928495 missense probably damaging 1.00
IGL03388:Epb41 APN 4 131974794 missense probably damaging 1.00
R0355:Epb41 UTSW 4 132000261 missense probably damaging 0.99
R0532:Epb41 UTSW 4 131978795 splice site probably benign
R0550:Epb41 UTSW 4 131975613 missense probably damaging 1.00
R1158:Epb41 UTSW 4 132000191 splice site probably benign
R1444:Epb41 UTSW 4 132006071 missense probably benign
R2106:Epb41 UTSW 4 131989841 missense probably damaging 1.00
R2269:Epb41 UTSW 4 131964147 missense probably benign 0.09
R4014:Epb41 UTSW 4 131982445 splice site probably benign
R4017:Epb41 UTSW 4 131982445 splice site probably benign
R4952:Epb41 UTSW 4 132000270 missense probably damaging 0.99
R4976:Epb41 UTSW 4 131937436 unclassified probably benign
R5058:Epb41 UTSW 4 132007435 utr 5 prime probably benign
R5119:Epb41 UTSW 4 131937436 unclassified probably benign
R5229:Epb41 UTSW 4 131978935 missense probably damaging 1.00
R5571:Epb41 UTSW 4 131937406 unclassified probably benign
R6250:Epb41 UTSW 4 131989873 missense probably damaging 1.00
R6531:Epb41 UTSW 4 131957636 missense probably benign 0.00
R6890:Epb41 UTSW 4 131935829 missense probably damaging 0.98
R7265:Epb41 UTSW 4 131967834 missense unknown
R7289:Epb41 UTSW 4 131991209 critical splice donor site probably null
R7322:Epb41 UTSW 4 131989719 missense probably damaging 0.99
R7823:Epb41 UTSW 4 131974682 critical splice donor site probably null
R8296:Epb41 UTSW 4 131937461 missense
R8317:Epb41 UTSW 4 131957650 missense
R8401:Epb41 UTSW 4 131974707 missense probably damaging 1.00
X0066:Epb41 UTSW 4 131974740 missense probably damaging 1.00
Z1177:Epb41 UTSW 4 132006083 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAACTCAGGGTGGCTCTTCCTATG -3'
(R):5'- ACTGACCAATTACCTGCCATGCTTC -3'

Sequencing Primer
(F):5'- GGCTCTTCCTATGGCAAACAATG -3'
(R):5'- TGCCATGCTTCCTTAGCAAG -3'
Posted On2013-06-11