Incidental Mutation 'R0571:Cttnbp2'
ID46450
Institutional Source Beutler Lab
Gene Symbol Cttnbp2
Ensembl Gene ENSMUSG00000000416
Gene Namecortactin binding protein 2
Synonyms4732477G22Rik, 3010022N24Rik, Cortbp2, ORF4, 9130022E09Rik
MMRRC Submission 038762-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0571 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location18366478-18514843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18381103 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1365 (M1365V)
Ref Sequence ENSEMBL: ENSMUSP00000088089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090601] [ENSMUST00000148602]
Predicted Effect probably benign
Transcript: ENSMUST00000090601
AA Change: M1365V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088089
Gene: ENSMUSG00000000416
AA Change: M1365V

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:CortBP2 32 138 3.1e-34 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
ANK 699 729 5.21e1 SMART
ANK 733 762 7.02e-5 SMART
ANK 766 795 6.55e-5 SMART
ANK 799 828 4.1e-6 SMART
ANK 832 861 1.09e-1 SMART
ANK 901 931 4.43e-2 SMART
Blast:AAA 1108 1285 1e-18 BLAST
low complexity region 1609 1623 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000146775
AA Change: M855V
SMART Domains Protein: ENSMUSP00000119383
Gene: ENSMUSG00000000416
AA Change: M855V

DomainStartEndE-ValueType
low complexity region 71 79 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
ANK 190 220 5.21e1 SMART
ANK 224 253 7.02e-5 SMART
ANK 257 286 6.55e-5 SMART
ANK 290 319 4.1e-6 SMART
ANK 323 352 1.09e-1 SMART
ANK 392 422 4.43e-2 SMART
Blast:AAA 599 776 1e-18 BLAST
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148602
SMART Domains Protein: ENSMUSP00000118432
Gene: ENSMUSG00000000416

DomainStartEndE-ValueType
Pfam:CortBP2 26 138 4.3e-50 PFAM
Pfam:CortBP2 134 180 1.3e-12 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152499
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with six ankyrin repeats and several proline-rich regions. A similar gene in rat interacts with a central regulator of the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,259,793 D2909G unknown Het
Abhd4 C T 14: 54,263,249 T165I possibly damaging Het
Acsl5 A G 19: 55,288,911 probably benign Het
Actl6b C A 5: 137,566,784 probably benign Het
Atg13 T C 2: 91,678,718 probably benign Het
Cabyr A G 18: 12,750,852 E132G probably damaging Het
Cadps2 C T 6: 23,583,412 V389I probably damaging Het
Capn2 C T 1: 182,470,760 V647I probably benign Het
Card10 G T 15: 78,787,401 P621Q possibly damaging Het
Catsperb C G 12: 101,602,774 H902D possibly damaging Het
Cers3 A G 7: 66,786,057 M255V possibly damaging Het
Cfh T C 1: 140,102,333 probably null Het
Chd3 A C 11: 69,361,669 probably null Het
Chpf2 G T 5: 24,590,427 R316L probably damaging Het
Clca1 T A 3: 145,007,789 N694Y probably damaging Het
Ctbp2 G A 7: 133,014,805 L44F probably damaging Het
D130052B06Rik G A 11: 33,623,922 R173H probably benign Het
Dchs1 A G 7: 105,771,996 F406L probably damaging Het
Ddx43 T A 9: 78,413,863 N384K possibly damaging Het
Drd5 G A 5: 38,319,927 V88M probably damaging Het
Eefsec A T 6: 88,297,899 F361Y probably benign Het
Epb41 T C 4: 131,989,904 D313G probably damaging Het
Etl4 T C 2: 20,743,769 M104T probably damaging Het
Fabp7 A T 10: 57,785,541 T37S probably benign Het
Fam186b T C 15: 99,286,953 T30A probably benign Het
Fam83d G A 2: 158,785,691 W433* probably null Het
Fmnl2 A T 2: 53,054,491 T161S probably benign Het
Ghsr C T 3: 27,372,016 R74C probably damaging Het
Gm6990 G A 19: 56,755,243 noncoding transcript Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Gtpbp4 A T 13: 8,990,686 probably benign Het
Hamp2 A G 7: 30,924,086 L17P possibly damaging Het
Heatr1 C A 13: 12,430,240 S1581R probably damaging Het
Hpf1 T C 8: 60,900,113 V176A probably benign Het
Hydin T A 8: 110,514,103 probably null Het
Ighg2c G A 12: 113,288,762 Q57* probably null Het
Itgb4 A G 11: 115,979,768 N141S possibly damaging Het
Kif13b G T 14: 64,751,528 R786L probably damaging Het
Lhx3 C A 2: 26,201,124 W391L probably damaging Het
Map1s T A 8: 70,912,907 V152D probably damaging Het
Map4 T C 9: 110,036,766 M608T probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mfn1 T C 3: 32,561,472 I328T probably damaging Het
Myh4 A T 11: 67,250,331 I740F possibly damaging Het
Neo1 A G 9: 58,985,786 V191A probably benign Het
Nfatc4 T C 14: 55,830,028 V565A probably damaging Het
Nrxn2 G C 19: 6,473,533 E525D probably damaging Het
Olfr361 T C 2: 37,085,334 H138R probably benign Het
Pcdhb12 A T 18: 37,437,208 D469V probably damaging Het
Pcdhb6 G T 18: 37,335,114 V363L probably benign Het
Pkd1l2 T C 8: 117,082,218 T78A probably benign Het
Primpol T G 8: 46,581,639 D418A probably damaging Het
Rbm12b1 G A 4: 12,146,248 S740N probably benign Het
Rpe65 T C 3: 159,600,349 L15P probably damaging Het
Rxrb CGCGGCGGCGGCGGCGGCGGC CGCGGCGGCGGCGGCGGC 17: 34,032,132 probably benign Het
Sectm1a A G 11: 121,069,102 probably benign Het
Sft2d1 C A 17: 8,326,950 probably benign Het
Slc22a18 A G 7: 143,491,861 probably benign Het
Slu7 G A 11: 43,441,578 probably null Het
Smc4 T C 3: 69,024,289 V572A probably damaging Het
Spire2 T A 8: 123,354,116 I33N probably damaging Het
Tbck T A 3: 132,752,642 C678S probably damaging Het
Tnrc6b T C 15: 80,913,338 V1362A probably damaging Het
Ttn T C 2: 76,739,982 K25110E possibly damaging Het
Ugt2b35 A G 5: 87,000,934 S15G possibly damaging Het
Upf3a T A 8: 13,792,184 I200K probably damaging Het
Vill G C 9: 119,070,633 G295A possibly damaging Het
Vmn1r191 A T 13: 22,179,047 V179D probably damaging Het
Vmn2r74 T C 7: 85,952,421 T670A probably damaging Het
Zfp169 T C 13: 48,489,690 T654A possibly damaging Het
Zfp646 A G 7: 127,881,966 E1105G probably damaging Het
Zyg11b A T 4: 108,260,042 Y334N probably damaging Het
Other mutations in Cttnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Cttnbp2 APN 6 18381062 missense possibly damaging 0.71
IGL01014:Cttnbp2 APN 6 18423895 missense probably damaging 0.98
IGL01148:Cttnbp2 APN 6 18382818 missense probably damaging 1.00
IGL01903:Cttnbp2 APN 6 18501965 missense probably damaging 1.00
IGL01906:Cttnbp2 APN 6 18378376 nonsense probably null
IGL01994:Cttnbp2 APN 6 18420815 missense possibly damaging 0.77
IGL02212:Cttnbp2 APN 6 18382749 missense possibly damaging 0.78
IGL02696:Cttnbp2 APN 6 18434129 missense probably benign 0.01
IGL02813:Cttnbp2 APN 6 18367538 missense possibly damaging 0.94
IGL02864:Cttnbp2 APN 6 18374549 missense probably benign 0.21
IGL03309:Cttnbp2 APN 6 18381036 missense probably damaging 0.98
FR4304:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4449:Cttnbp2 UTSW 6 18367462 utr 3 prime probably benign
FR4548:Cttnbp2 UTSW 6 18367463 utr 3 prime probably benign
FR4589:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367461 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367467 utr 3 prime probably benign
R0165:Cttnbp2 UTSW 6 18435410 nonsense probably null
R0382:Cttnbp2 UTSW 6 18435343 missense probably benign 0.39
R0464:Cttnbp2 UTSW 6 18408691 missense possibly damaging 0.81
R0550:Cttnbp2 UTSW 6 18435309 missense possibly damaging 0.89
R0627:Cttnbp2 UTSW 6 18367373 makesense probably null
R0788:Cttnbp2 UTSW 6 18423835 missense probably damaging 1.00
R0826:Cttnbp2 UTSW 6 18405178 splice site probably benign
R1319:Cttnbp2 UTSW 6 18434630 missense probably benign 0.00
R1476:Cttnbp2 UTSW 6 18434221 missense probably damaging 1.00
R1572:Cttnbp2 UTSW 6 18375975 missense possibly damaging 0.68
R1596:Cttnbp2 UTSW 6 18408592 missense probably damaging 1.00
R1607:Cttnbp2 UTSW 6 18435433 missense probably damaging 1.00
R1633:Cttnbp2 UTSW 6 18435167 missense probably damaging 1.00
R1634:Cttnbp2 UTSW 6 18408657 missense probably benign 0.39
R1661:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1665:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1834:Cttnbp2 UTSW 6 18501966 missense probably damaging 1.00
R1853:Cttnbp2 UTSW 6 18408602 missense probably benign 0.00
R1855:Cttnbp2 UTSW 6 18378413 missense probably benign
R2018:Cttnbp2 UTSW 6 18434518 missense probably damaging 1.00
R2169:Cttnbp2 UTSW 6 18426097 missense probably benign 0.00
R2175:Cttnbp2 UTSW 6 18434829 unclassified probably null
R2202:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2203:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2204:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2205:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2371:Cttnbp2 UTSW 6 18380604 missense possibly damaging 0.69
R2416:Cttnbp2 UTSW 6 18448286 missense probably damaging 0.99
R3414:Cttnbp2 UTSW 6 18389205 missense probably benign
R3617:Cttnbp2 UTSW 6 18414190 missense probably damaging 1.00
R3861:Cttnbp2 UTSW 6 18423833 missense probably benign 0.11
R3862:Cttnbp2 UTSW 6 18434906 missense probably benign 0.02
R3940:Cttnbp2 UTSW 6 18420975 missense probably benign 0.34
R3941:Cttnbp2 UTSW 6 18427453 missense probably benign 0.11
R4097:Cttnbp2 UTSW 6 18420872 missense probably benign
R4211:Cttnbp2 UTSW 6 18427543 missense probably damaging 1.00
R4353:Cttnbp2 UTSW 6 18514704 missense probably benign 0.00
R4367:Cttnbp2 UTSW 6 18405249 missense probably damaging 1.00
R4651:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4652:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4660:Cttnbp2 UTSW 6 18406537 missense probably benign 0.05
R4975:Cttnbp2 UTSW 6 18406526 missense possibly damaging 0.91
R5064:Cttnbp2 UTSW 6 18448279 missense probably damaging 1.00
R5205:Cttnbp2 UTSW 6 18427433 splice site probably benign
R5305:Cttnbp2 UTSW 6 18381098 missense probably benign
R5484:Cttnbp2 UTSW 6 18427690 intron probably benign
R5629:Cttnbp2 UTSW 6 18405218 missense probably damaging 1.00
R5763:Cttnbp2 UTSW 6 18414299 missense probably benign 0.00
R5766:Cttnbp2 UTSW 6 18381033 missense possibly damaging 0.87
R5942:Cttnbp2 UTSW 6 18448440 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18434233 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18448369 missense probably benign 0.01
R6163:Cttnbp2 UTSW 6 18434951 missense possibly damaging 0.91
R6545:Cttnbp2 UTSW 6 18405279 intron probably null
R6858:Cttnbp2 UTSW 6 18448453 missense probably damaging 1.00
R7037:Cttnbp2 UTSW 6 18435118 missense probably damaging 1.00
R7135:Cttnbp2 UTSW 6 18448447 missense possibly damaging 0.95
R7141:Cttnbp2 UTSW 6 18380468 missense probably benign 0.00
R7353:Cttnbp2 UTSW 6 18375944 missense possibly damaging 0.94
R7465:Cttnbp2 UTSW 6 18501992 missense probably damaging 1.00
R7500:Cttnbp2 UTSW 6 18378420 missense probably benign 0.00
R7534:Cttnbp2 UTSW 6 18420765 critical splice donor site probably null
R7646:Cttnbp2 UTSW 6 18375940 missense probably damaging 1.00
R7678:Cttnbp2 UTSW 6 18382810 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTTCGTTCATGCACAGCCC -3'
(R):5'- TGTTCCAAGTTCAGCCACAGTCCC -3'

Sequencing Primer
(F):5'- CTACATACCTGCCCTGGGAAG -3'
(R):5'- CTATTGATTTCAGGATTGAGACAGG -3'
Posted On2013-06-11