Incidental Mutation 'R0571:Slc22a18'
ID46459
Institutional Source Beutler Lab
Gene Symbol Slc22a18
Ensembl Gene ENSMUSG00000000154
Gene Namesolute carrier family 22 (organic cation transporter), member 18
Synonymsp45-BWR1A, Impt1, BWSCR1A, Orctl2, BWR1A, Slc22a1l, IMPT1, TSSC5
MMRRC Submission 038762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0571 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143473736-143499334 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 143491861 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052348] [ENSMUST00000105917] [ENSMUST00000141988] [ENSMUST00000145943] [ENSMUST00000150791]
Predicted Effect probably benign
Transcript: ENSMUST00000052348
SMART Domains Protein: ENSMUSP00000056082
Gene: ENSMUSG00000000154

DomainStartEndE-ValueType
Pfam:MFS_1 14 339 1.1e-31 PFAM
Pfam:MFS_1 229 410 5.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105917
SMART Domains Protein: ENSMUSP00000101537
Gene: ENSMUSG00000000154

DomainStartEndE-ValueType
Pfam:MFS_1 14 337 7.8e-32 PFAM
Pfam:MFS_3 66 346 6.5e-9 PFAM
Pfam:MFS_1 229 410 3.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141988
Predicted Effect probably benign
Transcript: ENSMUST00000145943
SMART Domains Protein: ENSMUSP00000115345
Gene: ENSMUSG00000000154

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150791
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. This gene is imprinted, with preferential expression from the maternal allele. Mutations in this gene have been found in Wilms' tumor and lung cancer. This protein may act as a transporter of organic cations, and have a role in the transport of chloroquine and quinidine-related compounds in kidney. Several alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,259,793 D2909G unknown Het
Abhd4 C T 14: 54,263,249 T165I possibly damaging Het
Acsl5 A G 19: 55,288,911 probably benign Het
Actl6b C A 5: 137,566,784 probably benign Het
Atg13 T C 2: 91,678,718 probably benign Het
Cabyr A G 18: 12,750,852 E132G probably damaging Het
Cadps2 C T 6: 23,583,412 V389I probably damaging Het
Capn2 C T 1: 182,470,760 V647I probably benign Het
Card10 G T 15: 78,787,401 P621Q possibly damaging Het
Catsperb C G 12: 101,602,774 H902D possibly damaging Het
Cers3 A G 7: 66,786,057 M255V possibly damaging Het
Cfh T C 1: 140,102,333 probably null Het
Chd3 A C 11: 69,361,669 probably null Het
Chpf2 G T 5: 24,590,427 R316L probably damaging Het
Clca1 T A 3: 145,007,789 N694Y probably damaging Het
Ctbp2 G A 7: 133,014,805 L44F probably damaging Het
Cttnbp2 T C 6: 18,381,103 M1365V probably benign Het
D130052B06Rik G A 11: 33,623,922 R173H probably benign Het
Dchs1 A G 7: 105,771,996 F406L probably damaging Het
Ddx43 T A 9: 78,413,863 N384K possibly damaging Het
Drd5 G A 5: 38,319,927 V88M probably damaging Het
Eefsec A T 6: 88,297,899 F361Y probably benign Het
Epb41 T C 4: 131,989,904 D313G probably damaging Het
Etl4 T C 2: 20,743,769 M104T probably damaging Het
Fabp7 A T 10: 57,785,541 T37S probably benign Het
Fam186b T C 15: 99,286,953 T30A probably benign Het
Fam83d G A 2: 158,785,691 W433* probably null Het
Fmnl2 A T 2: 53,054,491 T161S probably benign Het
Ghsr C T 3: 27,372,016 R74C probably damaging Het
Gm6990 G A 19: 56,755,243 noncoding transcript Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Gtpbp4 A T 13: 8,990,686 probably benign Het
Hamp2 A G 7: 30,924,086 L17P possibly damaging Het
Heatr1 C A 13: 12,430,240 S1581R probably damaging Het
Hpf1 T C 8: 60,900,113 V176A probably benign Het
Hydin T A 8: 110,514,103 probably null Het
Ighg2c G A 12: 113,288,762 Q57* probably null Het
Itgb4 A G 11: 115,979,768 N141S possibly damaging Het
Kif13b G T 14: 64,751,528 R786L probably damaging Het
Lhx3 C A 2: 26,201,124 W391L probably damaging Het
Map1s T A 8: 70,912,907 V152D probably damaging Het
Map4 T C 9: 110,036,766 M608T probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mfn1 T C 3: 32,561,472 I328T probably damaging Het
Myh4 A T 11: 67,250,331 I740F possibly damaging Het
Neo1 A G 9: 58,985,786 V191A probably benign Het
Nfatc4 T C 14: 55,830,028 V565A probably damaging Het
Nrxn2 G C 19: 6,473,533 E525D probably damaging Het
Olfr361 T C 2: 37,085,334 H138R probably benign Het
Pcdhb12 A T 18: 37,437,208 D469V probably damaging Het
Pcdhb6 G T 18: 37,335,114 V363L probably benign Het
Pkd1l2 T C 8: 117,082,218 T78A probably benign Het
Primpol T G 8: 46,581,639 D418A probably damaging Het
Rbm12b1 G A 4: 12,146,248 S740N probably benign Het
Rpe65 T C 3: 159,600,349 L15P probably damaging Het
Rxrb CGCGGCGGCGGCGGCGGCGGC CGCGGCGGCGGCGGCGGC 17: 34,032,132 probably benign Het
Sectm1a A G 11: 121,069,102 probably benign Het
Sft2d1 C A 17: 8,326,950 probably benign Het
Slu7 G A 11: 43,441,578 probably null Het
Smc4 T C 3: 69,024,289 V572A probably damaging Het
Spire2 T A 8: 123,354,116 I33N probably damaging Het
Tbck T A 3: 132,752,642 C678S probably damaging Het
Tnrc6b T C 15: 80,913,338 V1362A probably damaging Het
Ttn T C 2: 76,739,982 K25110E possibly damaging Het
Ugt2b35 A G 5: 87,000,934 S15G possibly damaging Het
Upf3a T A 8: 13,792,184 I200K probably damaging Het
Vill G C 9: 119,070,633 G295A possibly damaging Het
Vmn1r191 A T 13: 22,179,047 V179D probably damaging Het
Vmn2r74 T C 7: 85,952,421 T670A probably damaging Het
Zfp169 T C 13: 48,489,690 T654A possibly damaging Het
Zfp646 A G 7: 127,881,966 E1105G probably damaging Het
Zyg11b A T 4: 108,260,042 Y334N probably damaging Het
Other mutations in Slc22a18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01657:Slc22a18 APN 7 143499100 missense probably damaging 1.00
IGL01888:Slc22a18 APN 7 143479316 missense probably damaging 1.00
IGL02458:Slc22a18 APN 7 143492837 splice site probably benign
IGL02626:Slc22a18 APN 7 143499100 missense probably damaging 1.00
PIT4810001:Slc22a18 UTSW 7 143492931 missense probably benign 0.00
R0294:Slc22a18 UTSW 7 143492841 critical splice acceptor site probably null
R1951:Slc22a18 UTSW 7 143476247 missense probably damaging 1.00
R1953:Slc22a18 UTSW 7 143476247 missense probably damaging 1.00
R2352:Slc22a18 UTSW 7 143497415 missense probably benign 0.02
R3900:Slc22a18 UTSW 7 143479770 missense probably damaging 1.00
R5317:Slc22a18 UTSW 7 143499159 missense probably damaging 1.00
R5428:Slc22a18 UTSW 7 143479345 missense probably damaging 1.00
R7672:Slc22a18 UTSW 7 143490820 missense probably damaging 1.00
R7684:Slc22a18 UTSW 7 143490840 missense probably benign 0.00
R7688:Slc22a18 UTSW 7 143479823 missense probably damaging 1.00
R8130:Slc22a18 UTSW 7 143499174 missense probably damaging 1.00
R8443:Slc22a18 UTSW 7 143497386 missense probably damaging 0.96
Z1177:Slc22a18 UTSW 7 143497042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGCTCTAAGCATGAGGGACAAG -3'
(R):5'- CTGTGGTAGCAATTCAGAAGGGGAC -3'

Sequencing Primer
(F):5'- AGGCTGGAAGCCAGAGC -3'
(R):5'- AGGACTCAGCCTCCCTG -3'
Posted On2013-06-11