Incidental Mutation 'R0571:Upf3a'
ID46460
Institutional Source Beutler Lab
Gene Symbol Upf3a
Ensembl Gene ENSMUSG00000038398
Gene NameUPF3 regulator of nonsense transcripts homolog A (yeast)
Synonyms2600001C03Rik, RENT3A, 4930546M19Rik, UPF3
MMRRC Submission 038762-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0571 (G1)
Quality Score221
Status Validated
Chromosome8
Chromosomal Location13785615-13799193 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13792184 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 200 (I200K)
Ref Sequence ENSEMBL: ENSMUSP00000037354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043767]
Predicted Effect probably damaging
Transcript: ENSMUST00000043767
AA Change: I200K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037354
Gene: ENSMUSG00000038398
AA Change: I200K

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:Smg4_UPF3 63 224 1.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211724
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. The encoded protein is one of two functional homologs to yeast Upf3p. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. It forms with Y14 a complex that binds specifically 20 nt upstream of exon-exon junctions. This gene is located on the long arm of chromosome 13. Two splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: The gene product protects against mRNA transcript degradation. Homozygous constitutive KO is embryonic lethal. Homozygous conditional KO in testes leads to reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,259,793 D2909G unknown Het
Abhd4 C T 14: 54,263,249 T165I possibly damaging Het
Acsl5 A G 19: 55,288,911 probably benign Het
Actl6b C A 5: 137,566,784 probably benign Het
Atg13 T C 2: 91,678,718 probably benign Het
Cabyr A G 18: 12,750,852 E132G probably damaging Het
Cadps2 C T 6: 23,583,412 V389I probably damaging Het
Capn2 C T 1: 182,470,760 V647I probably benign Het
Card10 G T 15: 78,787,401 P621Q possibly damaging Het
Catsperb C G 12: 101,602,774 H902D possibly damaging Het
Cers3 A G 7: 66,786,057 M255V possibly damaging Het
Cfh T C 1: 140,102,333 probably null Het
Chd3 A C 11: 69,361,669 probably null Het
Chpf2 G T 5: 24,590,427 R316L probably damaging Het
Clca1 T A 3: 145,007,789 N694Y probably damaging Het
Ctbp2 G A 7: 133,014,805 L44F probably damaging Het
Cttnbp2 T C 6: 18,381,103 M1365V probably benign Het
D130052B06Rik G A 11: 33,623,922 R173H probably benign Het
Dchs1 A G 7: 105,771,996 F406L probably damaging Het
Ddx43 T A 9: 78,413,863 N384K possibly damaging Het
Drd5 G A 5: 38,319,927 V88M probably damaging Het
Eefsec A T 6: 88,297,899 F361Y probably benign Het
Epb41 T C 4: 131,989,904 D313G probably damaging Het
Etl4 T C 2: 20,743,769 M104T probably damaging Het
Fabp7 A T 10: 57,785,541 T37S probably benign Het
Fam186b T C 15: 99,286,953 T30A probably benign Het
Fam83d G A 2: 158,785,691 W433* probably null Het
Fmnl2 A T 2: 53,054,491 T161S probably benign Het
Ghsr C T 3: 27,372,016 R74C probably damaging Het
Gm6990 G A 19: 56,755,243 noncoding transcript Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Gtpbp4 A T 13: 8,990,686 probably benign Het
Hamp2 A G 7: 30,924,086 L17P possibly damaging Het
Heatr1 C A 13: 12,430,240 S1581R probably damaging Het
Hpf1 T C 8: 60,900,113 V176A probably benign Het
Hydin T A 8: 110,514,103 probably null Het
Ighg2c G A 12: 113,288,762 Q57* probably null Het
Itgb4 A G 11: 115,979,768 N141S possibly damaging Het
Kif13b G T 14: 64,751,528 R786L probably damaging Het
Lhx3 C A 2: 26,201,124 W391L probably damaging Het
Map1s T A 8: 70,912,907 V152D probably damaging Het
Map4 T C 9: 110,036,766 M608T probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mfn1 T C 3: 32,561,472 I328T probably damaging Het
Myh4 A T 11: 67,250,331 I740F possibly damaging Het
Neo1 A G 9: 58,985,786 V191A probably benign Het
Nfatc4 T C 14: 55,830,028 V565A probably damaging Het
Nrxn2 G C 19: 6,473,533 E525D probably damaging Het
Olfr361 T C 2: 37,085,334 H138R probably benign Het
Pcdhb12 A T 18: 37,437,208 D469V probably damaging Het
Pcdhb6 G T 18: 37,335,114 V363L probably benign Het
Pkd1l2 T C 8: 117,082,218 T78A probably benign Het
Primpol T G 8: 46,581,639 D418A probably damaging Het
Rbm12b1 G A 4: 12,146,248 S740N probably benign Het
Rpe65 T C 3: 159,600,349 L15P probably damaging Het
Rxrb CGCGGCGGCGGCGGCGGCGGC CGCGGCGGCGGCGGCGGC 17: 34,032,132 probably benign Het
Sectm1a A G 11: 121,069,102 probably benign Het
Sft2d1 C A 17: 8,326,950 probably benign Het
Slc22a18 A G 7: 143,491,861 probably benign Het
Slu7 G A 11: 43,441,578 probably null Het
Smc4 T C 3: 69,024,289 V572A probably damaging Het
Spire2 T A 8: 123,354,116 I33N probably damaging Het
Tbck T A 3: 132,752,642 C678S probably damaging Het
Tnrc6b T C 15: 80,913,338 V1362A probably damaging Het
Ttn T C 2: 76,739,982 K25110E possibly damaging Het
Ugt2b35 A G 5: 87,000,934 S15G possibly damaging Het
Vill G C 9: 119,070,633 G295A possibly damaging Het
Vmn1r191 A T 13: 22,179,047 V179D probably damaging Het
Vmn2r74 T C 7: 85,952,421 T670A probably damaging Het
Zfp169 T C 13: 48,489,690 T654A possibly damaging Het
Zfp646 A G 7: 127,881,966 E1105G probably damaging Het
Zyg11b A T 4: 108,260,042 Y334N probably damaging Het
Other mutations in Upf3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Upf3a APN 8 13786221 missense probably damaging 0.98
IGL01678:Upf3a APN 8 13791930 missense probably benign 0.21
IGL02072:Upf3a APN 8 13798368 missense probably damaging 0.99
R0309:Upf3a UTSW 8 13795500 splice site probably null
R0564:Upf3a UTSW 8 13795656 missense probably benign 0.42
R0826:Upf3a UTSW 8 13798338 missense possibly damaging 0.65
R1387:Upf3a UTSW 8 13792118 missense probably damaging 1.00
R1913:Upf3a UTSW 8 13792108 missense probably damaging 1.00
R2072:Upf3a UTSW 8 13785850 missense possibly damaging 0.63
R2520:Upf3a UTSW 8 13796443 intron probably null
R3845:Upf3a UTSW 8 13798238 missense probably benign 0.16
R4239:Upf3a UTSW 8 13796591 missense probably benign 0.28
R4424:Upf3a UTSW 8 13796573 missense probably benign 0.09
R5522:Upf3a UTSW 8 13795497 critical splice donor site probably null
R6321:Upf3a UTSW 8 13787466 missense possibly damaging 0.53
R6922:Upf3a UTSW 8 13791911 missense probably damaging 1.00
R7583:Upf3a UTSW 8 13785889 splice site probably null
R7585:Upf3a UTSW 8 13787418 missense probably damaging 1.00
R7695:Upf3a UTSW 8 13798279 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGGTGAGCCCTTTCCGAAAGC -3'
(R):5'- ACAAAGTGTCCTCTCTGAGCAGCC -3'

Sequencing Primer
(F):5'- GCCCTTTCCGAAAGCTGAATTG -3'
(R):5'- GGCCATTCTAAGCCAGGAC -3'
Posted On2013-06-11