Incidental Mutation 'R0571:Chd3'
ID 46475
Institutional Source Beutler Lab
Gene Symbol Chd3
Ensembl Gene ENSMUSG00000018474
Gene Name chromodomain helicase DNA binding protein 3
Synonyms 2600010P09Rik, Mi-2 alpha, Chd7, Prp7, Prp9-1
MMRRC Submission 038762-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0571 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 69234099-69260232 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 69252495 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661] [ENSMUST00000144701] [ENSMUST00000154046]
AlphaFold B1AR17
Predicted Effect probably null
Transcript: ENSMUST00000092971
SMART Domains Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 199 253 1.4e-34 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1754 1926 8.6e-104 PFAM
low complexity region 1935 1967 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108661
SMART Domains Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 200 253 4.3e-29 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1789 1960 4.9e-93 PFAM
low complexity region 1969 2001 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128981
SMART Domains Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 55 87 N/A INTRINSIC
Pfam:CHDNT 107 160 3.9e-29 PFAM
low complexity region 164 190 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
low complexity region 305 321 N/A INTRINSIC
PHD 341 384 1.54e-14 SMART
RING 342 383 4.25e-1 SMART
PHD 417 460 1.74e-13 SMART
RING 418 459 3.93e0 SMART
CHROMO 465 544 7.23e-14 SMART
CHROMO 588 637 2.85e-12 SMART
low complexity region 656 662 N/A INTRINSIC
DEXDc 691 903 1.64e-31 SMART
low complexity region 1014 1032 N/A INTRINSIC
HELICc 1049 1133 2.61e-25 SMART
low complexity region 1197 1210 N/A INTRINSIC
DUF1087 1252 1316 2.98e-33 SMART
DUF1086 1322 1478 1.79e-109 SMART
low complexity region 1480 1509 N/A INTRINSIC
low complexity region 1579 1592 N/A INTRINSIC
Pfam:CHDCT2 1662 1833 4.4e-93 PFAM
low complexity region 1842 1874 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000144701
SMART Domains Protein: ENSMUSP00000114520
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
PHD 84 127 1.54e-14 SMART
RING 85 126 4.25e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000154046
SMART Domains Protein: ENSMUSP00000121192
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
low complexity region 1 29 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
PHD 86 129 1.54e-14 SMART
RING 87 128 4.25e-1 SMART
Meta Mutation Damage Score 0.9504 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 C T 14: 54,500,706 (GRCm39) T165I possibly damaging Het
Acsl5 A G 19: 55,277,343 (GRCm39) probably benign Het
Actl6b C A 5: 137,565,046 (GRCm39) probably benign Het
Atg13 T C 2: 91,509,063 (GRCm39) probably benign Het
Cabyr A G 18: 12,883,909 (GRCm39) E132G probably damaging Het
Cadps2 C T 6: 23,583,411 (GRCm39) V389I probably damaging Het
Capn2 C T 1: 182,298,325 (GRCm39) V647I probably benign Het
Card10 G T 15: 78,671,601 (GRCm39) P621Q possibly damaging Het
Catsperb C G 12: 101,569,033 (GRCm39) H902D possibly damaging Het
Cers3 A G 7: 66,435,805 (GRCm39) M255V possibly damaging Het
Cfh T C 1: 140,030,071 (GRCm39) probably null Het
Chpf2 G T 5: 24,795,425 (GRCm39) R316L probably damaging Het
Clca3a1 T A 3: 144,713,550 (GRCm39) N694Y probably damaging Het
Cplane1 A G 15: 8,289,277 (GRCm39) D2909G unknown Het
Ctbp2 G A 7: 132,616,534 (GRCm39) L44F probably damaging Het
Cttnbp2 T C 6: 18,381,102 (GRCm39) M1365V probably benign Het
D130052B06Rik G A 11: 33,573,922 (GRCm39) R173H probably benign Het
Dchs1 A G 7: 105,421,203 (GRCm39) F406L probably damaging Het
Ddx43 T A 9: 78,321,145 (GRCm39) N384K possibly damaging Het
Drd5 G A 5: 38,477,270 (GRCm39) V88M probably damaging Het
Eefsec A T 6: 88,274,881 (GRCm39) F361Y probably benign Het
Epb41 T C 4: 131,717,215 (GRCm39) D313G probably damaging Het
Etl4 T C 2: 20,748,580 (GRCm39) M104T probably damaging Het
Fabp7 A T 10: 57,661,637 (GRCm39) T37S probably benign Het
Fam186b T C 15: 99,184,834 (GRCm39) T30A probably benign Het
Fam83d G A 2: 158,627,611 (GRCm39) W433* probably null Het
Fmnl2 A T 2: 52,944,503 (GRCm39) T161S probably benign Het
Ghsr C T 3: 27,426,165 (GRCm39) R74C probably damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Gtpbp4 A T 13: 9,040,722 (GRCm39) probably benign Het
Hamp2 A G 7: 30,623,511 (GRCm39) L17P possibly damaging Het
Heatr1 C A 13: 12,445,121 (GRCm39) S1581R probably damaging Het
Hpf1 T C 8: 61,353,147 (GRCm39) V176A probably benign Het
Hydin T A 8: 111,240,735 (GRCm39) probably null Het
Ighg2c G A 12: 113,252,382 (GRCm39) Q57* probably null Het
Itgb4 A G 11: 115,870,594 (GRCm39) N141S possibly damaging Het
Kif13b G T 14: 64,988,977 (GRCm39) R786L probably damaging Het
Lhx3 C A 2: 26,091,136 (GRCm39) W391L probably damaging Het
Map1s T A 8: 71,365,551 (GRCm39) V152D probably damaging Het
Map4 T C 9: 109,865,834 (GRCm39) M608T probably benign Het
Mb21d2 G A 16: 28,748,324 (GRCm39) A31V probably benign Het
Mfn1 T C 3: 32,615,621 (GRCm39) I328T probably damaging Het
Mif-ps9 G A 19: 56,743,675 (GRCm39) noncoding transcript Het
Myh4 A T 11: 67,141,157 (GRCm39) I740F possibly damaging Het
Neo1 A G 9: 58,893,069 (GRCm39) V191A probably benign Het
Nfatc4 T C 14: 56,067,485 (GRCm39) V565A probably damaging Het
Nrxn2 G C 19: 6,523,563 (GRCm39) E525D probably damaging Het
Or12k8 T C 2: 36,975,346 (GRCm39) H138R probably benign Het
Pcdhb12 A T 18: 37,570,261 (GRCm39) D469V probably damaging Het
Pcdhb6 G T 18: 37,468,167 (GRCm39) V363L probably benign Het
Pkd1l2 T C 8: 117,808,957 (GRCm39) T78A probably benign Het
Primpol T G 8: 47,034,674 (GRCm39) D418A probably damaging Het
Rbm12b1 G A 4: 12,146,248 (GRCm39) S740N probably benign Het
Rpe65 T C 3: 159,305,986 (GRCm39) L15P probably damaging Het
Rxrb CGCGGCGGCGGCGGCGGCGGC CGCGGCGGCGGCGGCGGC 17: 34,251,106 (GRCm39) probably benign Het
Sectm1a A G 11: 120,959,928 (GRCm39) probably benign Het
Sft2d1 C A 17: 8,545,782 (GRCm39) probably benign Het
Slc22a18 A G 7: 143,045,598 (GRCm39) probably benign Het
Slu7 G A 11: 43,332,405 (GRCm39) probably null Het
Smc4 T C 3: 68,931,622 (GRCm39) V572A probably damaging Het
Spire2 T A 8: 124,080,855 (GRCm39) I33N probably damaging Het
Tbck T A 3: 132,458,403 (GRCm39) C678S probably damaging Het
Tnrc6b T C 15: 80,797,539 (GRCm39) V1362A probably damaging Het
Ttn T C 2: 76,570,326 (GRCm39) K25110E possibly damaging Het
Ugt2b35 A G 5: 87,148,793 (GRCm39) S15G possibly damaging Het
Upf3a T A 8: 13,842,184 (GRCm39) I200K probably damaging Het
Vill G C 9: 118,899,701 (GRCm39) G295A possibly damaging Het
Vmn1r191 A T 13: 22,363,217 (GRCm39) V179D probably damaging Het
Vmn2r74 T C 7: 85,601,629 (GRCm39) T670A probably damaging Het
Zfp169 T C 13: 48,643,166 (GRCm39) T654A possibly damaging Het
Zfp646 A G 7: 127,481,138 (GRCm39) E1105G probably damaging Het
Zyg11b A T 4: 108,117,239 (GRCm39) Y334N probably damaging Het
Other mutations in Chd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Chd3 APN 11 69,247,888 (GRCm39) missense probably damaging 0.96
IGL00551:Chd3 APN 11 69,237,455 (GRCm39) missense probably damaging 1.00
IGL00661:Chd3 APN 11 69,248,209 (GRCm39) missense possibly damaging 0.84
IGL00698:Chd3 APN 11 69,240,697 (GRCm39) missense probably damaging 0.98
IGL01075:Chd3 APN 11 69,250,791 (GRCm39) missense probably damaging 1.00
IGL01309:Chd3 APN 11 69,248,557 (GRCm39) missense probably damaging 0.99
IGL01317:Chd3 APN 11 69,244,037 (GRCm39) missense probably damaging 1.00
IGL01374:Chd3 APN 11 69,250,806 (GRCm39) missense probably damaging 0.99
IGL01444:Chd3 APN 11 69,239,568 (GRCm39) missense probably benign 0.28
IGL01617:Chd3 APN 11 69,249,060 (GRCm39) unclassified probably benign
IGL01635:Chd3 APN 11 69,252,076 (GRCm39) splice site probably benign
IGL01942:Chd3 APN 11 69,240,931 (GRCm39) critical splice donor site probably null
IGL01962:Chd3 APN 11 69,248,319 (GRCm39) missense possibly damaging 0.46
IGL01981:Chd3 APN 11 69,251,501 (GRCm39) missense probably damaging 0.99
IGL02022:Chd3 APN 11 69,251,886 (GRCm39) missense probably damaging 1.00
IGL02098:Chd3 APN 11 69,250,655 (GRCm39) missense probably damaging 1.00
IGL02218:Chd3 APN 11 69,242,920 (GRCm39) unclassified probably benign
IGL02415:Chd3 APN 11 69,239,739 (GRCm39) splice site probably benign
IGL02648:Chd3 APN 11 69,242,976 (GRCm39) missense probably damaging 1.00
IGL02951:Chd3 APN 11 69,251,874 (GRCm39) critical splice donor site probably null
IGL03030:Chd3 APN 11 69,245,230 (GRCm39) missense possibly damaging 0.64
IGL03102:Chd3 APN 11 69,252,022 (GRCm39) nonsense probably null
IGL03168:Chd3 APN 11 69,239,741 (GRCm39) splice site probably benign
IGL03327:Chd3 APN 11 69,241,012 (GRCm39) missense probably damaging 1.00
burg UTSW 11 69,247,380 (GRCm39) missense probably damaging 1.00
castello UTSW 11 69,246,648 (GRCm39) critical splice acceptor site probably benign
feste UTSW 11 69,245,252 (GRCm39) nonsense probably null
Fortress UTSW 11 69,254,876 (GRCm39) nonsense probably null
moat UTSW 11 69,250,011 (GRCm39) missense probably damaging 0.98
Redoubt UTSW 11 69,244,727 (GRCm39) unclassified probably benign
schloss UTSW 11 69,252,886 (GRCm39) nonsense probably null
siege UTSW 11 69,247,844 (GRCm39) missense probably damaging 1.00
R0009:Chd3 UTSW 11 69,240,732 (GRCm39) missense probably damaging 0.99
R0009:Chd3 UTSW 11 69,240,732 (GRCm39) missense probably damaging 0.99
R0056:Chd3 UTSW 11 69,250,739 (GRCm39) unclassified probably benign
R0129:Chd3 UTSW 11 69,239,327 (GRCm39) nonsense probably null
R0130:Chd3 UTSW 11 69,250,656 (GRCm39) missense probably damaging 1.00
R0309:Chd3 UTSW 11 69,247,844 (GRCm39) missense probably damaging 1.00
R0330:Chd3 UTSW 11 69,247,159 (GRCm39) missense probably damaging 1.00
R0449:Chd3 UTSW 11 69,248,367 (GRCm39) missense probably damaging 0.98
R0502:Chd3 UTSW 11 69,244,931 (GRCm39) missense probably damaging 0.98
R0540:Chd3 UTSW 11 69,235,184 (GRCm39) missense probably damaging 0.98
R0607:Chd3 UTSW 11 69,235,184 (GRCm39) missense probably damaging 0.98
R0616:Chd3 UTSW 11 69,236,313 (GRCm39) missense probably damaging 0.96
R0630:Chd3 UTSW 11 69,238,021 (GRCm39) missense probably damaging 1.00
R1436:Chd3 UTSW 11 69,248,400 (GRCm39) splice site probably null
R1484:Chd3 UTSW 11 69,250,725 (GRCm39) missense probably benign 0.17
R1741:Chd3 UTSW 11 69,246,480 (GRCm39) missense probably damaging 1.00
R1748:Chd3 UTSW 11 69,255,523 (GRCm39) missense possibly damaging 0.81
R1751:Chd3 UTSW 11 69,244,727 (GRCm39) unclassified probably benign
R1833:Chd3 UTSW 11 69,244,949 (GRCm39) missense probably damaging 1.00
R2012:Chd3 UTSW 11 69,239,878 (GRCm39) missense probably benign 0.01
R2101:Chd3 UTSW 11 69,239,877 (GRCm39) missense probably benign
R2147:Chd3 UTSW 11 69,239,854 (GRCm39) missense probably benign 0.00
R2513:Chd3 UTSW 11 69,251,471 (GRCm39) missense probably damaging 1.00
R2877:Chd3 UTSW 11 69,251,998 (GRCm39) nonsense probably null
R2879:Chd3 UTSW 11 69,254,924 (GRCm39) missense possibly damaging 0.52
R2880:Chd3 UTSW 11 69,242,946 (GRCm39) missense probably damaging 1.00
R2881:Chd3 UTSW 11 69,242,946 (GRCm39) missense probably damaging 1.00
R2973:Chd3 UTSW 11 69,251,442 (GRCm39) missense probably damaging 1.00
R3611:Chd3 UTSW 11 69,252,973 (GRCm39) missense possibly damaging 0.53
R3743:Chd3 UTSW 11 69,254,876 (GRCm39) nonsense probably null
R3845:Chd3 UTSW 11 69,237,585 (GRCm39) missense possibly damaging 0.65
R3889:Chd3 UTSW 11 69,250,011 (GRCm39) missense probably damaging 0.98
R4007:Chd3 UTSW 11 69,239,827 (GRCm39) missense probably benign
R4115:Chd3 UTSW 11 69,248,343 (GRCm39) missense possibly damaging 0.95
R4515:Chd3 UTSW 11 69,240,703 (GRCm39) missense probably benign 0.00
R4612:Chd3 UTSW 11 69,244,035 (GRCm39) nonsense probably null
R4622:Chd3 UTSW 11 69,239,834 (GRCm39) missense probably damaging 0.98
R4634:Chd3 UTSW 11 69,253,013 (GRCm39) unclassified probably benign
R4635:Chd3 UTSW 11 69,253,013 (GRCm39) unclassified probably benign
R4859:Chd3 UTSW 11 69,250,722 (GRCm39) missense possibly damaging 0.79
R4930:Chd3 UTSW 11 69,245,034 (GRCm39) unclassified probably benign
R5173:Chd3 UTSW 11 69,260,069 (GRCm39) unclassified probably benign
R5287:Chd3 UTSW 11 69,239,895 (GRCm39) splice site probably null
R5403:Chd3 UTSW 11 69,239,895 (GRCm39) splice site probably null
R5511:Chd3 UTSW 11 69,252,301 (GRCm39) missense probably damaging 1.00
R5666:Chd3 UTSW 11 69,244,177 (GRCm39) missense possibly damaging 0.83
R5702:Chd3 UTSW 11 69,252,261 (GRCm39) missense possibly damaging 0.46
R6045:Chd3 UTSW 11 69,242,944 (GRCm39) missense possibly damaging 0.90
R6063:Chd3 UTSW 11 69,240,063 (GRCm39) missense probably benign
R6211:Chd3 UTSW 11 69,243,503 (GRCm39) missense probably damaging 1.00
R6215:Chd3 UTSW 11 69,247,380 (GRCm39) missense probably damaging 1.00
R6217:Chd3 UTSW 11 69,236,361 (GRCm39) missense probably damaging 1.00
R6302:Chd3 UTSW 11 69,244,604 (GRCm39) missense probably damaging 0.98
R6329:Chd3 UTSW 11 69,252,510 (GRCm39) missense possibly damaging 0.70
R6349:Chd3 UTSW 11 69,254,857 (GRCm39) missense possibly damaging 0.50
R6414:Chd3 UTSW 11 69,243,371 (GRCm39) critical splice donor site probably null
R6453:Chd3 UTSW 11 69,240,938 (GRCm39) nonsense probably null
R6548:Chd3 UTSW 11 69,252,886 (GRCm39) nonsense probably null
R6582:Chd3 UTSW 11 69,259,982 (GRCm39) unclassified probably benign
R6721:Chd3 UTSW 11 69,260,045 (GRCm39) unclassified probably benign
R6776:Chd3 UTSW 11 69,245,296 (GRCm39) missense probably damaging 1.00
R6900:Chd3 UTSW 11 69,245,271 (GRCm39) missense possibly damaging 0.64
R7085:Chd3 UTSW 11 69,260,027 (GRCm39) missense unknown
R7136:Chd3 UTSW 11 69,239,264 (GRCm39) missense probably null 0.37
R7164:Chd3 UTSW 11 69,253,132 (GRCm39) missense probably damaging 1.00
R7200:Chd3 UTSW 11 69,254,921 (GRCm39) missense possibly damaging 0.94
R7226:Chd3 UTSW 11 69,260,037 (GRCm39) missense unknown
R7238:Chd3 UTSW 11 69,254,873 (GRCm39) missense probably benign 0.31
R7316:Chd3 UTSW 11 69,236,394 (GRCm39) missense probably damaging 0.99
R7560:Chd3 UTSW 11 69,247,096 (GRCm39) missense probably damaging 1.00
R7684:Chd3 UTSW 11 69,248,692 (GRCm39) missense possibly damaging 0.83
R7748:Chd3 UTSW 11 69,246,459 (GRCm39) missense probably benign 0.00
R7820:Chd3 UTSW 11 69,244,064 (GRCm39) missense probably damaging 1.00
R7885:Chd3 UTSW 11 69,247,451 (GRCm39) missense probably benign 0.13
R8150:Chd3 UTSW 11 69,254,510 (GRCm39) missense probably benign 0.02
R8161:Chd3 UTSW 11 69,241,711 (GRCm39) missense probably damaging 1.00
R8271:Chd3 UTSW 11 69,251,483 (GRCm39) missense probably damaging 1.00
R8334:Chd3 UTSW 11 69,241,622 (GRCm39) missense probably damaging 1.00
R8423:Chd3 UTSW 11 69,245,252 (GRCm39) nonsense probably null
R8690:Chd3 UTSW 11 69,246,648 (GRCm39) critical splice acceptor site probably benign
R8828:Chd3 UTSW 11 69,247,097 (GRCm39) missense probably damaging 1.00
R8857:Chd3 UTSW 11 69,253,146 (GRCm39) missense probably benign 0.22
R9124:Chd3 UTSW 11 69,260,162 (GRCm39) missense unknown
R9170:Chd3 UTSW 11 69,241,648 (GRCm39) missense possibly damaging 0.64
R9213:Chd3 UTSW 11 69,255,628 (GRCm39) missense possibly damaging 0.53
R9285:Chd3 UTSW 11 69,249,954 (GRCm39) missense possibly damaging 0.64
R9293:Chd3 UTSW 11 69,244,027 (GRCm39) missense possibly damaging 0.94
R9368:Chd3 UTSW 11 69,251,200 (GRCm39) missense probably damaging 1.00
R9521:Chd3 UTSW 11 69,249,133 (GRCm39) missense probably benign 0.01
R9544:Chd3 UTSW 11 69,241,046 (GRCm39) missense probably damaging 1.00
R9554:Chd3 UTSW 11 69,251,015 (GRCm39) missense probably damaging 1.00
R9588:Chd3 UTSW 11 69,241,046 (GRCm39) missense probably damaging 1.00
X0022:Chd3 UTSW 11 69,247,084 (GRCm39) missense probably damaging 1.00
X0062:Chd3 UTSW 11 69,245,271 (GRCm39) missense possibly damaging 0.64
Z1186:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1186:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1187:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1187:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1188:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1188:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1189:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1189:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1190:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1190:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1191:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1191:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1192:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1192:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGGCACTATGGACACTACCACTG -3'
(R):5'- GCATGGCTTTGCAACTCCACAAC -3'

Sequencing Primer
(F):5'- GGACACTACCACTGTCCAGG -3'
(R):5'- ATGCTTTCCCAGCGGTG -3'
Posted On 2013-06-11