Incidental Mutation 'R0571:Gtpbp4'
ID46480
Institutional Source Beutler Lab
Gene Symbol Gtpbp4
Ensembl Gene ENSMUSG00000021149
Gene NameGTP binding protein 4
SynonymsNog1, 2610028C09Rik, Crfg
MMRRC Submission 038762-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R0571 (G1)
Quality Score180
Status Validated
Chromosome13
Chromosomal Location8966331-8996083 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 8990686 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021574] [ENSMUST00000222098]
Predicted Effect probably benign
Transcript: ENSMUST00000021574
SMART Domains Protein: ENSMUSP00000021574
Gene: ENSMUSG00000021149

DomainStartEndE-ValueType
Pfam:FeoB_N 169 335 4.7e-13 PFAM
Pfam:MMR_HSR1 170 290 1.7e-18 PFAM
Pfam:NOG1 235 292 1.3e-29 PFAM
Pfam:NOGCT 395 446 1.4e-24 PFAM
low complexity region 448 459 N/A INTRINSIC
low complexity region 467 479 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
low complexity region 560 575 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221534
Predicted Effect probably benign
Transcript: ENSMUST00000222098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223218
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GTP-binding proteins are GTPases and function as molecular switches that can flip between two states: active, when GTP is bound, and inactive, when GDP is bound. 'Active' in this context usually means that the molecule acts as a signal to trigger other events in the cell. When an extracellular ligand binds to a G-protein-linked receptor, the receptor changes its conformation and switches on the trimeric G proteins that associate with it by causing them to eject their GDP and replace it with GTP. The switch is turned off when the G protein hydrolyzes its own bound GTP, converting it back to GDP. But before that occurs, the active protein has an opportunity to diffuse away from the receptor and deliver its message for a prolonged period to its downstream target. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,259,793 D2909G unknown Het
Abhd4 C T 14: 54,263,249 T165I possibly damaging Het
Acsl5 A G 19: 55,288,911 probably benign Het
Actl6b C A 5: 137,566,784 probably benign Het
Atg13 T C 2: 91,678,718 probably benign Het
Cabyr A G 18: 12,750,852 E132G probably damaging Het
Cadps2 C T 6: 23,583,412 V389I probably damaging Het
Capn2 C T 1: 182,470,760 V647I probably benign Het
Card10 G T 15: 78,787,401 P621Q possibly damaging Het
Catsperb C G 12: 101,602,774 H902D possibly damaging Het
Cers3 A G 7: 66,786,057 M255V possibly damaging Het
Cfh T C 1: 140,102,333 probably null Het
Chd3 A C 11: 69,361,669 probably null Het
Chpf2 G T 5: 24,590,427 R316L probably damaging Het
Clca1 T A 3: 145,007,789 N694Y probably damaging Het
Ctbp2 G A 7: 133,014,805 L44F probably damaging Het
Cttnbp2 T C 6: 18,381,103 M1365V probably benign Het
D130052B06Rik G A 11: 33,623,922 R173H probably benign Het
Dchs1 A G 7: 105,771,996 F406L probably damaging Het
Ddx43 T A 9: 78,413,863 N384K possibly damaging Het
Drd5 G A 5: 38,319,927 V88M probably damaging Het
Eefsec A T 6: 88,297,899 F361Y probably benign Het
Epb41 T C 4: 131,989,904 D313G probably damaging Het
Etl4 T C 2: 20,743,769 M104T probably damaging Het
Fabp7 A T 10: 57,785,541 T37S probably benign Het
Fam186b T C 15: 99,286,953 T30A probably benign Het
Fam83d G A 2: 158,785,691 W433* probably null Het
Fmnl2 A T 2: 53,054,491 T161S probably benign Het
Ghsr C T 3: 27,372,016 R74C probably damaging Het
Gm6990 G A 19: 56,755,243 noncoding transcript Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hamp2 A G 7: 30,924,086 L17P possibly damaging Het
Heatr1 C A 13: 12,430,240 S1581R probably damaging Het
Hpf1 T C 8: 60,900,113 V176A probably benign Het
Hydin T A 8: 110,514,103 probably null Het
Ighg2c G A 12: 113,288,762 Q57* probably null Het
Itgb4 A G 11: 115,979,768 N141S possibly damaging Het
Kif13b G T 14: 64,751,528 R786L probably damaging Het
Lhx3 C A 2: 26,201,124 W391L probably damaging Het
Map1s T A 8: 70,912,907 V152D probably damaging Het
Map4 T C 9: 110,036,766 M608T probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mfn1 T C 3: 32,561,472 I328T probably damaging Het
Myh4 A T 11: 67,250,331 I740F possibly damaging Het
Neo1 A G 9: 58,985,786 V191A probably benign Het
Nfatc4 T C 14: 55,830,028 V565A probably damaging Het
Nrxn2 G C 19: 6,473,533 E525D probably damaging Het
Olfr361 T C 2: 37,085,334 H138R probably benign Het
Pcdhb12 A T 18: 37,437,208 D469V probably damaging Het
Pcdhb6 G T 18: 37,335,114 V363L probably benign Het
Pkd1l2 T C 8: 117,082,218 T78A probably benign Het
Primpol T G 8: 46,581,639 D418A probably damaging Het
Rbm12b1 G A 4: 12,146,248 S740N probably benign Het
Rpe65 T C 3: 159,600,349 L15P probably damaging Het
Rxrb CGCGGCGGCGGCGGCGGCGGC CGCGGCGGCGGCGGCGGC 17: 34,032,132 probably benign Het
Sectm1a A G 11: 121,069,102 probably benign Het
Sft2d1 C A 17: 8,326,950 probably benign Het
Slc22a18 A G 7: 143,491,861 probably benign Het
Slu7 G A 11: 43,441,578 probably null Het
Smc4 T C 3: 69,024,289 V572A probably damaging Het
Spire2 T A 8: 123,354,116 I33N probably damaging Het
Tbck T A 3: 132,752,642 C678S probably damaging Het
Tnrc6b T C 15: 80,913,338 V1362A probably damaging Het
Ttn T C 2: 76,739,982 K25110E possibly damaging Het
Ugt2b35 A G 5: 87,000,934 S15G possibly damaging Het
Upf3a T A 8: 13,792,184 I200K probably damaging Het
Vill G C 9: 119,070,633 G295A possibly damaging Het
Vmn1r191 A T 13: 22,179,047 V179D probably damaging Het
Vmn2r74 T C 7: 85,952,421 T670A probably damaging Het
Zfp169 T C 13: 48,489,690 T654A possibly damaging Het
Zfp646 A G 7: 127,881,966 E1105G probably damaging Het
Zyg11b A T 4: 108,260,042 Y334N probably damaging Het
Other mutations in Gtpbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Gtpbp4 APN 13 8977272 missense probably benign
IGL01319:Gtpbp4 APN 13 8985260 missense probably benign 0.05
IGL02108:Gtpbp4 APN 13 8985213 missense probably benign 0.20
IGL02116:Gtpbp4 APN 13 8992736 missense probably damaging 1.00
IGL02406:Gtpbp4 APN 13 8991750 missense possibly damaging 0.81
Atretic UTSW 13 8990737 nonsense probably null
enervated UTSW 13 8989105 missense possibly damaging 0.93
PIT4576001:Gtpbp4 UTSW 13 8991727 missense probably damaging 0.99
R0183:Gtpbp4 UTSW 13 8974961 missense probably benign 0.05
R1420:Gtpbp4 UTSW 13 8973262 missense probably benign 0.00
R1641:Gtpbp4 UTSW 13 8973249 missense probably benign 0.22
R1840:Gtpbp4 UTSW 13 8979464 missense probably benign 0.00
R1967:Gtpbp4 UTSW 13 8977304 missense probably benign 0.01
R2883:Gtpbp4 UTSW 13 8990723 missense possibly damaging 0.86
R3862:Gtpbp4 UTSW 13 8990798 missense probably damaging 0.99
R4524:Gtpbp4 UTSW 13 8974294 missense probably benign 0.02
R4963:Gtpbp4 UTSW 13 8985217 missense probably damaging 1.00
R5009:Gtpbp4 UTSW 13 8989066 missense probably benign 0.05
R5555:Gtpbp4 UTSW 13 8979427 critical splice donor site probably null
R5749:Gtpbp4 UTSW 13 8995947 critical splice donor site probably null
R5860:Gtpbp4 UTSW 13 8973160 missense probably benign 0.00
R6449:Gtpbp4 UTSW 13 8990737 nonsense probably null
R6616:Gtpbp4 UTSW 13 8989105 missense possibly damaging 0.93
R7261:Gtpbp4 UTSW 13 8987918 missense probably benign 0.12
R7829:Gtpbp4 UTSW 13 8985330 splice site probably null
R7999:Gtpbp4 UTSW 13 8987286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGATGCCTCAGCTCCTGAGAAAC -3'
(R):5'- ACAACCAGTGTGCTCCTATTGCCC -3'

Sequencing Primer
(F):5'- CTCAGCTCCTGAGAAACTGTATG -3'
(R):5'- CTACAGTGAGGAATTTGTGCCATC -3'
Posted On2013-06-11