Incidental Mutation 'R0571:Zfp169'
ID 46483
Institutional Source Beutler Lab
Gene Symbol Zfp169
Ensembl Gene ENSMUSG00000050954
Gene Name zinc finger protein 169
Synonyms 4930429A13Rik, 1700025J14Rik
MMRRC Submission 038762-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R0571 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 48641123-48666927 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48643166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 654 (T654A)
Ref Sequence ENSEMBL: ENSMUSP00000135414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110110] [ENSMUST00000167682] [ENSMUST00000176176] [ENSMUST00000176949] [ENSMUST00000176996] [ENSMUST00000177530]
AlphaFold E9Q3R6
Predicted Effect possibly damaging
Transcript: ENSMUST00000110110
AA Change: T654A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105737
Gene: ENSMUSG00000050954
AA Change: T654A

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167682
SMART Domains Protein: ENSMUSP00000127591
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176176
SMART Domains Protein: ENSMUSP00000134793
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176949
SMART Domains Protein: ENSMUSP00000135695
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176996
SMART Domains Protein: ENSMUSP00000135520
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177474
Predicted Effect possibly damaging
Transcript: ENSMUST00000177530
AA Change: T654A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135414
Gene: ENSMUSG00000050954
AA Change: T654A

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus does not result in an overt phenotype early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 C T 14: 54,500,706 (GRCm39) T165I possibly damaging Het
Acsl5 A G 19: 55,277,343 (GRCm39) probably benign Het
Actl6b C A 5: 137,565,046 (GRCm39) probably benign Het
Atg13 T C 2: 91,509,063 (GRCm39) probably benign Het
Cabyr A G 18: 12,883,909 (GRCm39) E132G probably damaging Het
Cadps2 C T 6: 23,583,411 (GRCm39) V389I probably damaging Het
Capn2 C T 1: 182,298,325 (GRCm39) V647I probably benign Het
Card10 G T 15: 78,671,601 (GRCm39) P621Q possibly damaging Het
Catsperb C G 12: 101,569,033 (GRCm39) H902D possibly damaging Het
Cers3 A G 7: 66,435,805 (GRCm39) M255V possibly damaging Het
Cfh T C 1: 140,030,071 (GRCm39) probably null Het
Chd3 A C 11: 69,252,495 (GRCm39) probably null Het
Chpf2 G T 5: 24,795,425 (GRCm39) R316L probably damaging Het
Clca3a1 T A 3: 144,713,550 (GRCm39) N694Y probably damaging Het
Cplane1 A G 15: 8,289,277 (GRCm39) D2909G unknown Het
Ctbp2 G A 7: 132,616,534 (GRCm39) L44F probably damaging Het
Cttnbp2 T C 6: 18,381,102 (GRCm39) M1365V probably benign Het
D130052B06Rik G A 11: 33,573,922 (GRCm39) R173H probably benign Het
Dchs1 A G 7: 105,421,203 (GRCm39) F406L probably damaging Het
Ddx43 T A 9: 78,321,145 (GRCm39) N384K possibly damaging Het
Drd5 G A 5: 38,477,270 (GRCm39) V88M probably damaging Het
Eefsec A T 6: 88,274,881 (GRCm39) F361Y probably benign Het
Epb41 T C 4: 131,717,215 (GRCm39) D313G probably damaging Het
Etl4 T C 2: 20,748,580 (GRCm39) M104T probably damaging Het
Fabp7 A T 10: 57,661,637 (GRCm39) T37S probably benign Het
Fam186b T C 15: 99,184,834 (GRCm39) T30A probably benign Het
Fam83d G A 2: 158,627,611 (GRCm39) W433* probably null Het
Fmnl2 A T 2: 52,944,503 (GRCm39) T161S probably benign Het
Ghsr C T 3: 27,426,165 (GRCm39) R74C probably damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Gtpbp4 A T 13: 9,040,722 (GRCm39) probably benign Het
Hamp2 A G 7: 30,623,511 (GRCm39) L17P possibly damaging Het
Heatr1 C A 13: 12,445,121 (GRCm39) S1581R probably damaging Het
Hpf1 T C 8: 61,353,147 (GRCm39) V176A probably benign Het
Hydin T A 8: 111,240,735 (GRCm39) probably null Het
Ighg2c G A 12: 113,252,382 (GRCm39) Q57* probably null Het
Itgb4 A G 11: 115,870,594 (GRCm39) N141S possibly damaging Het
Kif13b G T 14: 64,988,977 (GRCm39) R786L probably damaging Het
Lhx3 C A 2: 26,091,136 (GRCm39) W391L probably damaging Het
Map1s T A 8: 71,365,551 (GRCm39) V152D probably damaging Het
Map4 T C 9: 109,865,834 (GRCm39) M608T probably benign Het
Mb21d2 G A 16: 28,748,324 (GRCm39) A31V probably benign Het
Mfn1 T C 3: 32,615,621 (GRCm39) I328T probably damaging Het
Mif-ps9 G A 19: 56,743,675 (GRCm39) noncoding transcript Het
Myh4 A T 11: 67,141,157 (GRCm39) I740F possibly damaging Het
Neo1 A G 9: 58,893,069 (GRCm39) V191A probably benign Het
Nfatc4 T C 14: 56,067,485 (GRCm39) V565A probably damaging Het
Nrxn2 G C 19: 6,523,563 (GRCm39) E525D probably damaging Het
Or12k8 T C 2: 36,975,346 (GRCm39) H138R probably benign Het
Pcdhb12 A T 18: 37,570,261 (GRCm39) D469V probably damaging Het
Pcdhb6 G T 18: 37,468,167 (GRCm39) V363L probably benign Het
Pkd1l2 T C 8: 117,808,957 (GRCm39) T78A probably benign Het
Primpol T G 8: 47,034,674 (GRCm39) D418A probably damaging Het
Rbm12b1 G A 4: 12,146,248 (GRCm39) S740N probably benign Het
Rpe65 T C 3: 159,305,986 (GRCm39) L15P probably damaging Het
Rxrb CGCGGCGGCGGCGGCGGCGGC CGCGGCGGCGGCGGCGGC 17: 34,251,106 (GRCm39) probably benign Het
Sectm1a A G 11: 120,959,928 (GRCm39) probably benign Het
Sft2d1 C A 17: 8,545,782 (GRCm39) probably benign Het
Slc22a18 A G 7: 143,045,598 (GRCm39) probably benign Het
Slu7 G A 11: 43,332,405 (GRCm39) probably null Het
Smc4 T C 3: 68,931,622 (GRCm39) V572A probably damaging Het
Spire2 T A 8: 124,080,855 (GRCm39) I33N probably damaging Het
Tbck T A 3: 132,458,403 (GRCm39) C678S probably damaging Het
Tnrc6b T C 15: 80,797,539 (GRCm39) V1362A probably damaging Het
Ttn T C 2: 76,570,326 (GRCm39) K25110E possibly damaging Het
Ugt2b35 A G 5: 87,148,793 (GRCm39) S15G possibly damaging Het
Upf3a T A 8: 13,842,184 (GRCm39) I200K probably damaging Het
Vill G C 9: 118,899,701 (GRCm39) G295A possibly damaging Het
Vmn1r191 A T 13: 22,363,217 (GRCm39) V179D probably damaging Het
Vmn2r74 T C 7: 85,601,629 (GRCm39) T670A probably damaging Het
Zfp646 A G 7: 127,481,138 (GRCm39) E1105G probably damaging Het
Zyg11b A T 4: 108,117,239 (GRCm39) Y334N probably damaging Het
Other mutations in Zfp169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Zfp169 APN 13 48,644,239 (GRCm39) unclassified probably benign
IGL03329:Zfp169 APN 13 48,644,270 (GRCm39) unclassified probably benign
IGL03382:Zfp169 APN 13 48,644,639 (GRCm39) unclassified probably benign
IGL03394:Zfp169 APN 13 48,643,400 (GRCm39) missense possibly damaging 0.93
BB010:Zfp169 UTSW 13 48,643,957 (GRCm39) missense unknown
BB020:Zfp169 UTSW 13 48,643,957 (GRCm39) missense unknown
R1714:Zfp169 UTSW 13 48,652,330 (GRCm39) missense probably benign 0.35
R1784:Zfp169 UTSW 13 48,643,295 (GRCm39) missense possibly damaging 0.61
R3108:Zfp169 UTSW 13 48,643,472 (GRCm39) missense possibly damaging 0.86
R3689:Zfp169 UTSW 13 48,660,377 (GRCm39) splice site probably benign
R4444:Zfp169 UTSW 13 48,643,813 (GRCm39) missense possibly damaging 0.94
R4665:Zfp169 UTSW 13 48,644,339 (GRCm39) unclassified probably benign
R4719:Zfp169 UTSW 13 48,643,634 (GRCm39) missense probably benign 0.06
R4745:Zfp169 UTSW 13 48,643,708 (GRCm39) missense possibly damaging 0.71
R5288:Zfp169 UTSW 13 48,643,751 (GRCm39) missense possibly damaging 0.61
R5384:Zfp169 UTSW 13 48,643,751 (GRCm39) missense possibly damaging 0.61
R5979:Zfp169 UTSW 13 48,644,516 (GRCm39) unclassified probably benign
R6053:Zfp169 UTSW 13 48,652,334 (GRCm39) missense probably damaging 1.00
R6823:Zfp169 UTSW 13 48,644,472 (GRCm39) unclassified probably benign
R7084:Zfp169 UTSW 13 48,652,339 (GRCm39) missense probably benign 0.10
R7679:Zfp169 UTSW 13 48,651,859 (GRCm39) missense probably damaging 0.99
R7933:Zfp169 UTSW 13 48,643,957 (GRCm39) missense unknown
R8298:Zfp169 UTSW 13 48,651,853 (GRCm39) nonsense probably null
R8322:Zfp169 UTSW 13 48,644,575 (GRCm39) missense unknown
R9047:Zfp169 UTSW 13 48,652,292 (GRCm39) missense probably damaging 1.00
R9124:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
R9126:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
R9131:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
R9132:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGCCCACAATGCCCGTTCTTAG -3'
(R):5'- TCAGGCAGAAGTTCAACCTCGC -3'

Sequencing Primer
(F):5'- ATGAGGTGTCATCCCATCCAG -3'
(R):5'- GAAGTTCAACCTCGCTAGGC -3'
Posted On 2013-06-11