Mutagenetix > Incidental Mutations

Incidental Mutation 'R0571:Nrxn2'

46496

Institutional Source

Beutler Lab

Gene Symbol

Nrxn2

Ensembl Gene

ENSMUSG00000033768

Gene Name

neurexin II

Synonyms

6430591O13Rik, neurexin II beta, neurexin II alpha

MMRRC Submission

038762-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0571 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

6418731-6544169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 6473533 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 525 (E525D)

Ref Sequence

ENSEMBL: ENSMUSP00000119762 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077182] [ENSMUST00000113461] [ENSMUST00000113462] [ENSMUST00000137166] [ENSMUST00000137821]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077182
AA Change: E510D

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000076424
Gene: ENSMUSG00000033768
AA Change: E510D

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
LamG	49	187	1.67e-33	SMART
EGF	205	242	1.73e1	SMART
low complexity region	268	276	N/A	INTRINSIC
LamG	310	444	1.18e-33	SMART
LamG	498	651	1.51e-40	SMART
EGF	678	712	8.91e-3	SMART
LamG	737	875	4.91e-22	SMART
LamG	923	1059	1.08e-41	SMART
EGF	1084	1118	1.91e1	SMART
LamG	1146	1303	4.48e-16	SMART
low complexity region	1332	1362	N/A	INTRINSIC
low complexity region	1430	1445	N/A	INTRINSIC
4.1m	1448	1466	3.75e-4	SMART
low complexity region	1480	1499	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113461
AA Change: E494D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109088
Gene: ENSMUSG00000033768
AA Change: E494D

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
LamG	49	187	1.67e-33	SMART
EGF	205	242	1.73e1	SMART
LamG	286	428	8.4e-30	SMART
LamG	482	635	1.51e-40	SMART
EGF	662	696	8.91e-3	SMART
LamG	721	850	2.36e-24	SMART
LamG	898	1034	1.08e-41	SMART
EGF	1059	1093	1.91e1	SMART
LamG	1121	1248	1.26e-19	SMART
low complexity region	1277	1307	N/A	INTRINSIC
low complexity region	1363	1384	N/A	INTRINSIC
low complexity region	1567	1582	N/A	INTRINSIC
4.1m	1585	1603	3.75e-4	SMART
low complexity region	1617	1636	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113462
AA Change: E518D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109089
Gene: ENSMUSG00000033768
AA Change: E518D

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
LamG	49	187	1.67e-33	SMART
EGF	205	242	1.73e1	SMART
low complexity region	268	276	N/A	INTRINSIC
LamG	310	452	8.4e-30	SMART
LamG	506	659	1.51e-40	SMART
EGF	686	720	8.91e-3	SMART
LamG	745	883	4.91e-22	SMART
LamG	931	1067	1.08e-41	SMART
EGF	1092	1126	1.91e1	SMART
LamG	1154	1311	4.48e-16	SMART
low complexity region	1340	1370	N/A	INTRINSIC
low complexity region	1426	1447	N/A	INTRINSIC
low complexity region	1630	1645	N/A	INTRINSIC
4.1m	1648	1666	3.75e-4	SMART
low complexity region	1680	1699	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124815

Predicted Effect

probably damaging
Transcript: ENSMUST00000137166
AA Change: E525D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119762
Gene: ENSMUSG00000033768
AA Change: E525D

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
LamG	49	187	1.67e-33	SMART
EGF	205	242	1.73e1	SMART
low complexity region	268	276	N/A	INTRINSIC
LamG	310	459	8.87e-29	SMART
LamG	513	666	1.51e-40	SMART
EGF	693	727	8.91e-3	SMART
LamG	752	890	4.91e-22	SMART
LamG	938	1074	1.08e-41	SMART
EGF	1099	1133	1.91e1	SMART
LamG	1161	1318	4.48e-16	SMART
low complexity region	1347	1377	N/A	INTRINSIC
low complexity region	1433	1454	N/A	INTRINSIC
low complexity region	1637	1652	N/A	INTRINSIC
4.1m	1655	1673	3.75e-4	SMART
low complexity region	1687	1706	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137821

SMART Domains

Protein: ENSMUSP00000122920
Gene: ENSMUSG00000033768

Domain	Start	End	E-Value	Type
EGF	6	43	1.73e1	SMART
low complexity region	59	67	N/A	INTRINSIC
LamG	101	212	1.63e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140435

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150792

Predicted Effect

probably benign
Transcript: ENSMUST00000155158

SMART Domains

Protein: ENSMUSP00000118878
Gene: ENSMUSG00000033768

Domain	Start	End	E-Value	Type
Blast:LamG	2	45	8e-7	BLAST
LamG	71	205	1.18e-33	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157014

Meta Mutation Damage Score

0.1478

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.9%
20x: 94.7%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin gene family. The products of these genes function as cell adhesion molecules and receptors in the vertebrate nervous system. These genes utilize two promoters. The majority of transcripts are produced from the upstream promoter and encode alpha-neurexin isoforms while a smaller number of transcripts are produced from the downstream promoter and encode beta-neuresin isoforms. The alpha-neurexins contain epidermal growth factor-like (EGF-like) sequences and laminin G domains, and have been shown to interact with neurexophilins. The beta-neurexins lack EGF-like sequences and contain fewer laminin G domains than alpha-neurexins. Alternative splicing and the use of alternative promoters may generate thousands of transcript variants (PMID: 12036300, PMID: 11944992).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are generally non-viable; surviving homozygotes show a 30-40% decrease in body weight and their inhibitory postsynaptic currents (IPSCs) are decreased in cortical slice cultures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	G	15: 8,259,793	D2909G	unknown	Het
Abhd4	C	T	14: 54,263,249	T165I	possibly damaging	Het
Acsl5	A	G	19: 55,288,911		probably benign	Het
Actl6b	C	A	5: 137,566,784		probably benign	Het
Atg13	T	C	2: 91,678,718		probably benign	Het
Cabyr	A	G	18: 12,750,852	E132G	probably damaging	Het
Cadps2	C	T	6: 23,583,412	V389I	probably damaging	Het
Capn2	C	T	1: 182,470,760	V647I	probably benign	Het
Card10	G	T	15: 78,787,401	P621Q	possibly damaging	Het
Catsperb	C	G	12: 101,602,774	H902D	possibly damaging	Het
Cers3	A	G	7: 66,786,057	M255V	possibly damaging	Het
Cfh	T	C	1: 140,102,333		probably null	Het
Chd3	A	C	11: 69,361,669		probably null	Het
Chpf2	G	T	5: 24,590,427	R316L	probably damaging	Het
Clca1	T	A	3: 145,007,789	N694Y	probably damaging	Het
Ctbp2	G	A	7: 133,014,805	L44F	probably damaging	Het
Cttnbp2	T	C	6: 18,381,103	M1365V	probably benign	Het
D130052B06Rik	G	A	11: 33,623,922	R173H	probably benign	Het
Dchs1	A	G	7: 105,771,996	F406L	probably damaging	Het
Ddx43	T	A	9: 78,413,863	N384K	possibly damaging	Het
Drd5	G	A	5: 38,319,927	V88M	probably damaging	Het
Eefsec	A	T	6: 88,297,899	F361Y	probably benign	Het
Epb41	T	C	4: 131,989,904	D313G	probably damaging	Het
Etl4	T	C	2: 20,743,769	M104T	probably damaging	Het
Fabp7	A	T	10: 57,785,541	T37S	probably benign	Het
Fam186b	T	C	15: 99,286,953	T30A	probably benign	Het
Fam83d	G	A	2: 158,785,691	W433*	probably null	Het
Fmnl2	A	T	2: 53,054,491	T161S	probably benign	Het
Ghsr	C	T	3: 27,372,016	R74C	probably damaging	Het
Gm6990	G	A	19: 56,755,243		noncoding transcript	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Gtpbp4	A	T	13: 8,990,686		probably benign	Het
Hamp2	A	G	7: 30,924,086	L17P	possibly damaging	Het
Heatr1	C	A	13: 12,430,240	S1581R	probably damaging	Het
Hpf1	T	C	8: 60,900,113	V176A	probably benign	Het
Hydin	T	A	8: 110,514,103		probably null	Het
Ighg2c	G	A	12: 113,288,762	Q57*	probably null	Het
Itgb4	A	G	11: 115,979,768	N141S	possibly damaging	Het
Kif13b	G	T	14: 64,751,528	R786L	probably damaging	Het
Lhx3	C	A	2: 26,201,124	W391L	probably damaging	Het
Map1s	T	A	8: 70,912,907	V152D	probably damaging	Het
Map4	T	C	9: 110,036,766	M608T	probably benign	Het
Mb21d2	G	A	16: 28,929,572	A31V	probably benign	Het
Mfn1	T	C	3: 32,561,472	I328T	probably damaging	Het
Myh4	A	T	11: 67,250,331	I740F	possibly damaging	Het
Neo1	A	G	9: 58,985,786	V191A	probably benign	Het
Nfatc4	T	C	14: 55,830,028	V565A	probably damaging	Het
Olfr361	T	C	2: 37,085,334	H138R	probably benign	Het
Pcdhb12	A	T	18: 37,437,208	D469V	probably damaging	Het
Pcdhb6	G	T	18: 37,335,114	V363L	probably benign	Het
Pkd1l2	T	C	8: 117,082,218	T78A	probably benign	Het
Primpol	T	G	8: 46,581,639	D418A	probably damaging	Het
Rbm12b1	G	A	4: 12,146,248	S740N	probably benign	Het
Rpe65	T	C	3: 159,600,349	L15P	probably damaging	Het
Rxrb	CGCGGCGGCGGCGGCGGCGGC	CGCGGCGGCGGCGGCGGC	17: 34,032,132		probably benign	Het
Sectm1a	A	G	11: 121,069,102		probably benign	Het
Sft2d1	C	A	17: 8,326,950		probably benign	Het
Slc22a18	A	G	7: 143,491,861		probably benign	Het
Slu7	G	A	11: 43,441,578		probably null	Het
Smc4	T	C	3: 69,024,289	V572A	probably damaging	Het
Spire2	T	A	8: 123,354,116	I33N	probably damaging	Het
Tbck	T	A	3: 132,752,642	C678S	probably damaging	Het
Tnrc6b	T	C	15: 80,913,338	V1362A	probably damaging	Het
Ttn	T	C	2: 76,739,982	K25110E	possibly damaging	Het
Ugt2b35	A	G	5: 87,000,934	S15G	possibly damaging	Het
Upf3a	T	A	8: 13,792,184	I200K	probably damaging	Het
Vill	G	C	9: 119,070,633	G295A	possibly damaging	Het
Vmn1r191	A	T	13: 22,179,047	V179D	probably damaging	Het
Vmn2r74	T	C	7: 85,952,421	T670A	probably damaging	Het
Zfp169	T	C	13: 48,489,690	T654A	possibly damaging	Het
Zfp646	A	G	7: 127,881,966	E1105G	probably damaging	Het
Zyg11b	A	T	4: 108,260,042	Y334N	probably damaging	Het

Other mutations in Nrxn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Nrxn2	APN	19	6473593	missense	possibly damaging	0.84
IGL01020:Nrxn2	APN	19	6493443	missense	probably benign	0.02
IGL01064:Nrxn2	APN	19	6517053	missense	probably damaging	0.97
IGL01561:Nrxn2	APN	19	6490142	missense	probably damaging	1.00
IGL01759:Nrxn2	APN	19	6509929	missense	probably damaging	1.00
IGL02071:Nrxn2	APN	19	6481753	missense	probably damaging	1.00
IGL02085:Nrxn2	APN	19	6492868	missense	possibly damaging	0.83
IGL02132:Nrxn2	APN	19	6472276	missense	probably damaging	1.00
IGL02476:Nrxn2	APN	19	6454985	missense	probably damaging	1.00
IGL02605:Nrxn2	APN	19	6450580	missense	probably benign	0.02
IGL03123:Nrxn2	APN	19	6481737	missense	probably damaging	0.98
IGL03288:Nrxn2	APN	19	6490696	missense	probably damaging	1.00
PIT4687001:Nrxn2	UTSW	19	6481308	missense	probably benign	0.06
R0019:Nrxn2	UTSW	19	6509957	splice site	probably benign
R0257:Nrxn2	UTSW	19	6490698	missense	possibly damaging	0.81
R0305:Nrxn2	UTSW	19	6519283	missense	probably damaging	1.00
R0453:Nrxn2	UTSW	19	6491521	missense	probably damaging	1.00
R0512:Nrxn2	UTSW	19	6517198	missense	probably damaging	1.00
R0539:Nrxn2	UTSW	19	6493404	missense	probably damaging	0.99
R1373:Nrxn2	UTSW	19	6472301	missense	probably damaging	1.00
R1434:Nrxn2	UTSW	19	6443612	splice site	probably null
R1454:Nrxn2	UTSW	19	6481446	missense	probably damaging	0.98
R1671:Nrxn2	UTSW	19	6473750	missense	probably damaging	1.00
R1692:Nrxn2	UTSW	19	6519268	missense	probably damaging	1.00
R1858:Nrxn2	UTSW	19	6488795	missense	probably benign	0.01
R1859:Nrxn2	UTSW	19	6488795	missense	probably benign	0.01
R2153:Nrxn2	UTSW	19	6504914	missense	probably damaging	1.00
R2196:Nrxn2	UTSW	19	6490109	missense	probably damaging	1.00
R2209:Nrxn2	UTSW	19	6493007	missense	probably benign	0.01
R2278:Nrxn2	UTSW	19	6481853	missense	probably damaging	1.00
R2441:Nrxn2	UTSW	19	6428301	missense	probably damaging	1.00
R3897:Nrxn2	UTSW	19	6519257	missense	probably damaging	1.00
R3943:Nrxn2	UTSW	19	6473335	missense	probably damaging	1.00
R4091:Nrxn2	UTSW	19	6473414	missense	probably damaging	1.00
R4162:Nrxn2	UTSW	19	6532143	missense	probably damaging	1.00
R4164:Nrxn2	UTSW	19	6532143	missense	probably damaging	1.00
R4495:Nrxn2	UTSW	19	6531399	missense	probably benign	0.05
R4599:Nrxn2	UTSW	19	6455252	missense	probably damaging	0.98
R4735:Nrxn2	UTSW	19	6498454	missense	possibly damaging	0.86
R4757:Nrxn2	UTSW	19	6509821	missense	probably damaging	1.00
R4890:Nrxn2	UTSW	19	6448278	missense	possibly damaging	0.90
R5052:Nrxn2	UTSW	19	6455204	missense	probably damaging	1.00
R5311:Nrxn2	UTSW	19	6531398	missense	probably benign	0.05
R5330:Nrxn2	UTSW	19	6490081	missense	probably damaging	0.96
R5331:Nrxn2	UTSW	19	6490081	missense	probably damaging	0.96
R5530:Nrxn2	UTSW	19	6498367	missense	possibly damaging	0.93
R5556:Nrxn2	UTSW	19	6490091	missense	probably damaging	1.00
R5763:Nrxn2	UTSW	19	6531339	missense	probably benign	0.15
R5829:Nrxn2	UTSW	19	6490849	missense	probably benign	0.03
R5988:Nrxn2	UTSW	19	6492871	missense	possibly damaging	0.83
R6003:Nrxn2	UTSW	19	6498328	missense	possibly damaging	0.93
R6032:Nrxn2	UTSW	19	6517132	missense	probably damaging	1.00
R6032:Nrxn2	UTSW	19	6517132	missense	probably damaging	1.00
R6288:Nrxn2	UTSW	19	6490561	missense	probably damaging	1.00
R6334:Nrxn2	UTSW	19	6531292	splice site	probably null
R6373:Nrxn2	UTSW	19	6509830	missense	probably damaging	1.00
R6397:Nrxn2	UTSW	19	6532122	missense	probably damaging	1.00
R6669:Nrxn2	UTSW	19	6481191	missense	probably damaging	1.00
R6980:Nrxn2	UTSW	19	6450579	missense	probably benign	0.04
R6985:Nrxn2	UTSW	19	6481245	missense	probably damaging	1.00
R7184:Nrxn2	UTSW	19	6490552	missense	probably damaging	1.00
R7361:Nrxn2	UTSW	19	6517082	missense	probably benign	0.00
R7576:Nrxn2	UTSW	19	6531510	nonsense	probably null
R7604:Nrxn2	UTSW	19	6531961	missense	probably damaging	1.00
R7631:Nrxn2	UTSW	19	6481795	missense	possibly damaging	0.83
R7768:Nrxn2	UTSW	19	6481379	missense	possibly damaging	0.69
R7805:Nrxn2	UTSW	19	6531706	missense	probably benign
R7896:Nrxn2	UTSW	19	6532053	missense	possibly damaging	0.89
R7998:Nrxn2	UTSW	19	6509875	missense	probably damaging	0.98
R8383:Nrxn2	UTSW	19	6472313	missense	probably damaging	1.00
R8505:Nrxn2	UTSW	19	6490133	missense	probably damaging	1.00
X0022:Nrxn2	UTSW	19	6509917	missense	probably damaging	1.00
Z1177:Nrxn2	UTSW	19	6498517	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATGACTTCAAGCTGGAGCTGTCCC -3'
(R):5'- TGACCTTGCGTGACTGTTCCTG -3'

Sequencing Primer
(F):5'- TCCCGACTGGCTAAGGAAG -3'
(R):5'- AGTATGAATCCAGGTCCCTGC -3'

Posted On

2013-06-11