Incidental Mutation 'R0571:Acsl5'
ID46497
Institutional Source Beutler Lab
Gene Symbol Acsl5
Ensembl Gene ENSMUSG00000024981
Gene Nameacyl-CoA synthetase long-chain family member 5
SynonymsFacl5, 1700030F05Rik
MMRRC Submission 038762-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0571 (G1)
Quality Score143
Status Validated
Chromosome19
Chromosomal Location55251938-55297720 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 55288911 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043150] [ENSMUST00000225963] [ENSMUST00000226103]
Predicted Effect probably benign
Transcript: ENSMUST00000043150
SMART Domains Protein: ENSMUSP00000046585
Gene: ENSMUSG00000024981

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:AMP-binding 82 548 2.7e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226019
Predicted Effect probably benign
Transcript: ENSMUST00000226103
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in uterus and spleen, and in trace amounts in normal brain, but has markedly increased levels in malignant gliomas. This gene functions in mediating fatty acid-induced glioma cell growth. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit decreased mean bone mineral content and density measurements when compared with controls. A notably decreased mean platelet count is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,259,793 D2909G unknown Het
Abhd4 C T 14: 54,263,249 T165I possibly damaging Het
Actl6b C A 5: 137,566,784 probably benign Het
Atg13 T C 2: 91,678,718 probably benign Het
Cabyr A G 18: 12,750,852 E132G probably damaging Het
Cadps2 C T 6: 23,583,412 V389I probably damaging Het
Capn2 C T 1: 182,470,760 V647I probably benign Het
Card10 G T 15: 78,787,401 P621Q possibly damaging Het
Catsperb C G 12: 101,602,774 H902D possibly damaging Het
Cers3 A G 7: 66,786,057 M255V possibly damaging Het
Cfh T C 1: 140,102,333 probably null Het
Chd3 A C 11: 69,361,669 probably null Het
Chpf2 G T 5: 24,590,427 R316L probably damaging Het
Clca1 T A 3: 145,007,789 N694Y probably damaging Het
Ctbp2 G A 7: 133,014,805 L44F probably damaging Het
Cttnbp2 T C 6: 18,381,103 M1365V probably benign Het
D130052B06Rik G A 11: 33,623,922 R173H probably benign Het
Dchs1 A G 7: 105,771,996 F406L probably damaging Het
Ddx43 T A 9: 78,413,863 N384K possibly damaging Het
Drd5 G A 5: 38,319,927 V88M probably damaging Het
Eefsec A T 6: 88,297,899 F361Y probably benign Het
Epb41 T C 4: 131,989,904 D313G probably damaging Het
Etl4 T C 2: 20,743,769 M104T probably damaging Het
Fabp7 A T 10: 57,785,541 T37S probably benign Het
Fam186b T C 15: 99,286,953 T30A probably benign Het
Fam83d G A 2: 158,785,691 W433* probably null Het
Fmnl2 A T 2: 53,054,491 T161S probably benign Het
Ghsr C T 3: 27,372,016 R74C probably damaging Het
Gm6990 G A 19: 56,755,243 noncoding transcript Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Gtpbp4 A T 13: 8,990,686 probably benign Het
Hamp2 A G 7: 30,924,086 L17P possibly damaging Het
Heatr1 C A 13: 12,430,240 S1581R probably damaging Het
Hpf1 T C 8: 60,900,113 V176A probably benign Het
Hydin T A 8: 110,514,103 probably null Het
Ighg2c G A 12: 113,288,762 Q57* probably null Het
Itgb4 A G 11: 115,979,768 N141S possibly damaging Het
Kif13b G T 14: 64,751,528 R786L probably damaging Het
Lhx3 C A 2: 26,201,124 W391L probably damaging Het
Map1s T A 8: 70,912,907 V152D probably damaging Het
Map4 T C 9: 110,036,766 M608T probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mfn1 T C 3: 32,561,472 I328T probably damaging Het
Myh4 A T 11: 67,250,331 I740F possibly damaging Het
Neo1 A G 9: 58,985,786 V191A probably benign Het
Nfatc4 T C 14: 55,830,028 V565A probably damaging Het
Nrxn2 G C 19: 6,473,533 E525D probably damaging Het
Olfr361 T C 2: 37,085,334 H138R probably benign Het
Pcdhb12 A T 18: 37,437,208 D469V probably damaging Het
Pcdhb6 G T 18: 37,335,114 V363L probably benign Het
Pkd1l2 T C 8: 117,082,218 T78A probably benign Het
Primpol T G 8: 46,581,639 D418A probably damaging Het
Rbm12b1 G A 4: 12,146,248 S740N probably benign Het
Rpe65 T C 3: 159,600,349 L15P probably damaging Het
Rxrb CGCGGCGGCGGCGGCGGCGGC CGCGGCGGCGGCGGCGGC 17: 34,032,132 probably benign Het
Sectm1a A G 11: 121,069,102 probably benign Het
Sft2d1 C A 17: 8,326,950 probably benign Het
Slc22a18 A G 7: 143,491,861 probably benign Het
Slu7 G A 11: 43,441,578 probably null Het
Smc4 T C 3: 69,024,289 V572A probably damaging Het
Spire2 T A 8: 123,354,116 I33N probably damaging Het
Tbck T A 3: 132,752,642 C678S probably damaging Het
Tnrc6b T C 15: 80,913,338 V1362A probably damaging Het
Ttn T C 2: 76,739,982 K25110E possibly damaging Het
Ugt2b35 A G 5: 87,000,934 S15G possibly damaging Het
Upf3a T A 8: 13,792,184 I200K probably damaging Het
Vill G C 9: 119,070,633 G295A possibly damaging Het
Vmn1r191 A T 13: 22,179,047 V179D probably damaging Het
Vmn2r74 T C 7: 85,952,421 T670A probably damaging Het
Zfp169 T C 13: 48,489,690 T654A possibly damaging Het
Zfp646 A G 7: 127,881,966 E1105G probably damaging Het
Zyg11b A T 4: 108,260,042 Y334N probably damaging Het
Other mutations in Acsl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Acsl5 APN 19 55272833 missense probably benign 0.02
IGL02792:Acsl5 APN 19 55293731 critical splice donor site probably null
lyrebird UTSW 19 55272819 nonsense probably null
paradise UTSW 19 55278183 missense
IGL02796:Acsl5 UTSW 19 55278169 nonsense probably null
R0206:Acsl5 UTSW 19 55280569 missense probably benign
R0400:Acsl5 UTSW 19 55293711 missense probably damaging 0.99
R0418:Acsl5 UTSW 19 55272806 missense probably benign 0.16
R0626:Acsl5 UTSW 19 55284472 missense probably benign 0.00
R0792:Acsl5 UTSW 19 55280492 missense probably benign 0.01
R1144:Acsl5 UTSW 19 55291843 missense probably damaging 1.00
R1477:Acsl5 UTSW 19 55291472 missense probably benign 0.23
R1522:Acsl5 UTSW 19 55280492 missense probably benign 0.01
R1927:Acsl5 UTSW 19 55278154 missense probably benign 0.37
R2495:Acsl5 UTSW 19 55293599 nonsense probably null
R4153:Acsl5 UTSW 19 55281463 missense probably benign 0.23
R4570:Acsl5 UTSW 19 55291774 missense probably damaging 0.99
R4721:Acsl5 UTSW 19 55280530 missense probably benign 0.00
R4834:Acsl5 UTSW 19 55280559 missense probably benign 0.00
R5270:Acsl5 UTSW 19 55294218 missense possibly damaging 0.50
R5360:Acsl5 UTSW 19 55291160 nonsense probably null
R5436:Acsl5 UTSW 19 55279565 critical splice donor site probably null
R5458:Acsl5 UTSW 19 55294230 missense probably damaging 1.00
R5479:Acsl5 UTSW 19 55280462 missense probably damaging 1.00
R5812:Acsl5 UTSW 19 55294836 missense probably benign 0.01
R6232:Acsl5 UTSW 19 55280501 missense possibly damaging 0.69
R6821:Acsl5 UTSW 19 55288836 missense probably benign 0.03
R6874:Acsl5 UTSW 19 55291863 missense probably damaging 1.00
R7030:Acsl5 UTSW 19 55272819 nonsense probably null
R7156:Acsl5 UTSW 19 55268828 splice site probably null
R7293:Acsl5 UTSW 19 55291210 missense probably damaging 0.98
R7543:Acsl5 UTSW 19 55278183 missense
R7728:Acsl5 UTSW 19 55287853 nonsense probably null
R7977:Acsl5 UTSW 19 55277973 critical splice donor site probably null
R7987:Acsl5 UTSW 19 55277973 critical splice donor site probably null
R8017:Acsl5 UTSW 19 55268796 missense probably benign
R8221:Acsl5 UTSW 19 55268830 critical splice donor site probably null
X0013:Acsl5 UTSW 19 55293664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGGAATGGTGATGGCTCCAATAG -3'
(R):5'- TGGATGCTACTGGGAAACTGTGAATG -3'

Sequencing Primer
(F):5'- TTGTAAGTCAACCAAGTTGGACAG -3'
(R):5'- CTAAGCTTTTTGGTAAGGAGACC -3'
Posted On2013-06-11